REG3G (NM_001008387) Human Untagged Clone
CAT#: SC301280
REG3G (untagged)-Human regenerating islet-derived 3 gamma (REG3G), transcript variant 1
"NM_001008387" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | REG3G |
Synonyms | LPPM429; PAP-1B; PAP1B; PAP IB; PAPIB; REG-III; REG III; UNQ429 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001008387 edited
CCCAGTCTTTGCTGACCAGACAAAGCATACCAGATCTCACCAGAGAGTCGCAGACACTAT GCTGCCTCCCATGGCCCTGCCCAGTGTGTCCTGGATGCTGCTTTCCTGCCTCATTCTCCT GTGTCAGGTTCAAGGTGAAGAAACCCAGAAGGAACTGCCCTCTCCACGGATCAGCTGTCC CAAAGGCTCCAAGGCCTATGGCTCCCCCTGCTATGCCTTGTTTTTGTCACCAAAATCCTG GATGGATGCAGATCTGGCTTGCCAGAAGCGGCCCTCTGGAAAACTGGTGTCTGTGCTCAG TGGGGCTGAGGGATCCTTCGTGTCCTCCCTGGTGAGGAGCATTAGTAACAGCTACTCATA CATCTGGATTGGGCTCCATGACCCCACACAGGGCTCTGAGCCTGATGGAGATGGATGGGA GTGGAGTAGCACTGATGTGATGAATTACTTTGCATGGGAGAAAAATCCCTCCACCATCTT AAACCCTGGCCACTGTGGGAGCCTGTCAAGAAGCACAGGATTTCTGAAGTGGAAAGATTA TAACTGTGATGCAAAGTTACCCTATGTCTGCAAGTTCAAGGACTAGGGCAGGTGGGAAGT CAGCAGCCTCAGCT |
Restriction Sites | Please inquire |
ACCN | NM_001008387 |
ORF Size | 528 bp |
Insert Size | 600 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001008387.1. |
Reference Data | |
RefSeq | NM_001008387.1, NP_001008388.1 |
RefSeq Size | 947 |
RefSeq ORF | 528 |
Locus ID | 130120 |
Protein Families | Secreted Protein |
Gene Summary | This gene encodes a member of the regenerating islet-derived genes (REG)3 protein family. These proteins are secreted, C-type lectins with a carbohydrate recognition domain and N-terminal signal peptide. The protein encoded by this gene is an antimicrobial lectin with activity against Gram-positive bacteria. Alternative splicing results in multiple transcript variants encoding multiple isoforms. [provided by RefSeq, Nov 2014] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Variants 1 and 2 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223733 | REG3G (Myc-DDK-tagged)-Human regenerating islet-derived 3 gamma (REG3G), transcript variant 1 |
USD 420.00 |
|
RG223733 | REG3G (GFP-tagged) - Human regenerating islet-derived 3 gamma (REG3G), transcript variant 1 |
USD 460.00 |
|
RC223733L1 | Lenti ORF clone of Human regenerating islet-derived 3 gamma (REG3G), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC223733L2 | Lenti ORF clone of Human regenerating islet-derived 3 gamma (REG3G), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC223733L3 | Lenti ORF clone of Human regenerating islet-derived 3 gamma (REG3G), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC223733L4 | Lenti ORF clone of Human regenerating islet-derived 3 gamma (REG3G), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review