AKAP14 (NM_001008535) Human Untagged Clone

CAT#: SC301317

AKAP14 (untagged)-Human A kinase (PRKA) anchor protein 14 (AKAP14), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: AKAP14
• Synonyms: AKAP28; PRKA14
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001008535, the custom clone sequence may differ by one or more nucleotides
  ATGAGTGAGACTCAAAATTCAACAAGCCAGAAAGCAATGGATGAGGATAACAAAGCCGCA
  AGCCAAACAATGCCGAATACACAAGACAAGAACTACGAGGATGAATTGACTCAAGTAGCT
  CTAGCTCTGGTTGAGGATGTCATCAATTATGCTGTTAAGATTGTGGAAGAGGAGCGAAAC
  CCTTTGAAAAACATCAAGTGGATGACTCACGGTGAATTCACTGTGGAAAAGGGTCTTAAA
  CAAATTGACGAATATTTTTCGGTAAGTTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001008535
• ORF Size: 270 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001008535.1, NP_001008535.1
• RefSeq Size: 481
• RefSeq ORF: 270
• Locus ID: 158798
• Protein Families: Druggable Genome
• Gene Summary: The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The protein anchors PKA in ciliary axonemes and, in this way, may play a role in regulating ciliary beat frequency. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) uses an alternate splice site, compared to variant 1, that results in a frameshift. It encodes isoform c which has a shorter and distinct C-terminus compared to isoform a.