CCBL2 (KYAT3) (NM_001008662) Human Untagged Clone
CAT#: SC301338
CCBL2 (untagged)-Human cysteine conjugate-beta lyase 2 (CCBL2), transcript variant 2
"NM_001008662" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KYAT3 |
Synonyms | CCBL2; KAT3; KATIII |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001008662, the custom clone sequence may differ by one or more nucleotides
ATGTCACTGAAATTCACAAATGCAAAACGGATTGAAGGACTTGATAGTAATGTGTGGATTGAATTTACCA AATTGGCTGCAGACCCTTCTGTTGTGAATCTTGGCCAAGGCTTTCCAGATATATCCCCTCCTACATATGT AAAAGAAGAATTATCAAAGATTGCAGCAATCGATAGCCTGAATCAGTATACACGAGGCTTTGGCCATCCA TCACTTGTGAAAGCTCTGTCCTATCTGTATGAAAAGCTTTATCAAAAGCAAATTGATTCAAATAAAGAAA TCCTTGTGACAGTAGGAGCATATGGATCTCTTTTTAACACCATTCAAGCATTAATTGATGAGGGAGATGA AGTCATACTAATAGTGCCTTTCTATGACTGCTATGAGCCCATGGTGAGAATGGCTGGAGCAACACCTGTT TTTATTCCCCTGAGATCTAAACCTGTTTATGGAAAAAGATGGTCTAGTTCTGACTGGACATTAGATCCTC AAGAACTGGAAAGTAAATTTAATTCCAAAACCAAAGCTATTATACTAAATACTCCACATAACCCACTTGG CAAGGTGTATAACAGAGAGGAACTGCAAGTAATTGCTGACCTTTGCATCAAATATGACACACTCTGCATC AGCGATGAGGTTTATGAATGGCTTGTATATTCTGGAAATAAGCACTTAAAAATAGCTACTTTTCCAGGTA TGTGGGAGAGAACAATAACAATAGGAAGTGCTGGAAAGACTTTCAGTGTAACTGGCTGGAAGCTTGGCTG GTCCATTGGTCCAAATCATTTGATAAAACATTTACAGACAGTTCAACAAAACACGATTTATACTTGTGCA ACTCCTTTACAGGAAGCCTTGGCTCAAGCTTTCTGGATTGACATCAAGCGCATGGATGACCCAGAATGTT ACTTTAATTCTTTGCCAAAAGAGTTAGAAGTAAAAAGAGATCGGATGGTACGTTTACTTGAAAGTGTTGG CCTAAAACCCATAGTTCCTGATGGAGGATACTTCATCATCGCTGATGTGTCTTTGCTAGATCCAGACCTC TCTGATATGAAGAATAATGAGCCTTATGACTATAAGTTTGTGAAATGGATGACTAAACATAAGAAACTAT CAGCCATCCCCGTTTCAGCATTCTGTAACTCAGAGACTAAATCACAGTTTGAGAAGTTTGTGCGTTTTTG CTTCATTAAAAAAGACAGCACACTGGATGCTGCTGAAGAAATCATCAAGGCATGGAGTGTACAGAAGTCT TGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001008662 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001008662.2, NP_001008662.1 |
RefSeq Size | 2065 bp |
RefSeq ORF | 1263 bp |
Locus ID | 56267 |
Cytogenetics | 1p22.2 |
Gene Summary | This gene encodes an aminotransferase that transaminates kynurenine to form kynurenic acid, which is a metabolite of tryptophan. Multiple alternatively spliced transcript variants that encode different proteins have been described for this gene. This gene shares 5' exon structure with the RNA binding motif protein, X-linked-like 1 locus on chromosome 1, but the coding sequences are non-overlapping. [provided by RefSeq, Mar 2017] Transcript Variant: This variant (2) lacks an alternate exon in the 5' region and uses a downstream start codon compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. Variants 2 and 3 encode the same isoform (2). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217351 | CCBL2 (Myc-DDK-tagged)-Human cysteine conjugate-beta lyase 2 (CCBL2), transcript variant 2 |
USD 420.00 |
|
RG217351 | CCBL2 (GFP-tagged) - Human cysteine conjugate-beta lyase 2 (CCBL2), transcript variant 2 |
USD 460.00 |
|
RC217351L3 | Lenti ORF clone of Human cysteine conjugate-beta lyase 2 (CCBL2), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC217351L4 | Lenti ORF clone of Human cysteine conjugate-beta lyase 2 (CCBL2), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review