CST9 (NM_001008693) Human Untagged Clone
CAT#: SC301339
CST9 (untagged)-Human cystatin 9 (testatin) (CST9)
"NM_001008693" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CST9 |
Synonyms | CLM; CTES7A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001008693, the custom clone sequence may differ by one or more nucleotides
ATGTCGAGTCCGCAGAGGAGGAAGGCTATGCCCTGGGCACTGTCACTGCTTCTCATGGGCTTCCAGCTCC TGGTGACTTATGCCTGGTGTTCTGAAGAGGAAATGGGTGGTAATAATAAAATAGTCCAGGATCCTATGTT CCTCGCCACAGTGGAGTTTGCCTTGAACACTTTCAACGTGCAGAGCAAGGAGGAGCATGCCTACAGGCTG TTGCGCGTCCTGAGTTCATGGAGGGAGGATAGCATGGACAGAAAGTGGCGAGGTAAGATGGTGTTCTCCA TGAATCTGCAACTGCGCCAAACCGTATGTAGGAAATTTGAAGATGACATTGACAACTGCCCTTTTCAAGA AAGCCTGGAGCTGAACAACGTAAGACAGGGCATCAGCTTTCCTCAGGTCCACAGCTGTGGATGCTGCATG GGGTGTGGTGTGGGCACAGGAGCAGCTGACAAAGCCATTCCGAGGGACAAAGGGAAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001008693 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001008693.2, NP_001008693.2 |
RefSeq Size | 1689 bp |
RefSeq ORF | 480 bp |
Locus ID | 128822 |
Cytogenetics | 20p11.21 |
Protein Families | Transmembrane |
Gene Summary | The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions, where they appear to provide protective functions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a secreted protein that may play a role in hematopoietic differentiation or inflammation. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220815 | CST9 (Myc-DDK-tagged)-Human cystatin 9 (testatin) (CST9) |
USD 420.00 |
|
RG220815 | CST9 (GFP-tagged) - Human cystatin 9 (testatin) (CST9) |
USD 460.00 |
|
RC220815L3 | Lenti ORF clone of Human cystatin 9 (testatin) (CST9), Myc-DDK-tagged |
USD 620.00 |
|
RC220815L4 | Lenti ORF clone of Human cystatin 9 (testatin) (CST9), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review