Gemin 2 (GEMIN2) (NM_001009182) Human Untagged Clone

CAT#: SC301394

GEMIN2 (untagged)-Human survival of motor neuron protein interacting protein 1 (SIP1), transcript variant beta

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GEMIN2
• Synonyms: SIP1; SIP1-delta
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001009182, the custom clone sequence may differ by one or more nucleotides
  ATGCGCCGAGCGGAACTGGCTGGTTTGAAAACCATGGCGTGGGTACCAGCGGAGTCCGCA
  GTGGAAGAGTTGATGCCTCGGCTATTGCCGGTAGAGCCTTGCGACTTGACGGAAGGTTTC
  GATCCCTCGGTACCCCCGAGGACGCCTCAGGAATACCTGAGGCGGGTCCAGATCGAAGCA
  GCTCAATGTCCAGATGTTGTGGTAGCTCAAATTGACCCAAAGAAGTTGAAAAGGAAGCAA
  AGTGTGAATATTTCTCTTTCAGGATGCCAACCCGCCCCTGAAGGTTATTCCCCAACACTT
  CAATGGCAACAGCAACAAGTGGCACAGTTTTCAACTGTTCGACAGAATGTGAACAAACAT
  AGAAGTCACTGGAAATCACAACAGTTGGATAGTAATGTGACAATGCCAAAATCTGAAGAT
  GAAGAAGGCTGGAAGAAATTTTGTCTGGGTGAAAAGTTATGTGCTGACGGGGCTGTTGGA
  CCAGCCACAAATGAAAGTCCTGGAATAGATTATGTACAAGCAACAGTAACTAGTGTCTTG
  GAATATCTGAGTAATTGGTTTGGAGAAAGAGACTTTACTCCAGAATTGGGAAGATGGCTT
  TATGCTTTATTGGCTTGTCTTGAAAAGCCTTTGTTACCTGAGGCTCATTCACTGATTCGG
  CAGCTTGCAAGAAGGTGCTCTGAAGTGAGGCTCTTAGTGGATAGCAAAGATGATGAGAGG
  GTTCCTGCTTTGAATTTATTAATCTGCTTGGTTAGCAGGTATTTTGACCAACGTGATTTA
  GCTGATGAGCCATCTTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001009182
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001009182.1, NP_001009182.1
• RefSeq Size: 1323 bp
• RefSeq ORF: 798 bp
• Locus ID: 8487
• Cytogenetics: 14q21.1
• Protein Families: Druggable Genome, Stem cell - Pluripotency
• Gene Summary: This gene encodes one of the proteins found in the SMN complex, which consists of several gemin proteins and the protein known as the survival of motor neuron protein. The SMN complex is localized to a subnuclear compartment called gems (gemini of coiled bodies) and is required for assembly of spliceosomal snRNPs and for pre-mRNA splicing. This protein interacts directly with the survival of motor neuron protein and it is required for formation of the SMN complex. A knockout mouse targeting the mouse homolog of this gene exhibited disrupted snRNP assembly and motor neuron degeneration. [provided by RefSeq, Aug 2011]
  Transcript Variant: This variant (beta) lacks an in-frame exon, compared to variant alpha. It encodes isoform beta which is shorter than isoform alpha.