Pirh2 (RCHY1) (NM_001009922) Human Untagged Clone
CAT#: SC301441
RCHY1 (untagged)-Human ring finger and CHY zinc finger domain containing 1 (RCHY1), transcript variant 3
"NM_001009922" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RCHY1 |
Synonyms | ARNIP; CHIMP; PIRH2; PRO1996; RNF199; ZCHY; ZNF363 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001009922, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCGACGGCCCGGGAAGATGGCGCCAGCGGTCAAGAGCGAGGTCAGCGGGGCTGC GAGCACTATGACAGAGGATGTCTCCTAAAGGCACCTTGCTGTGACAAGCTTTATACTTGC CGCTTGTGTCATGATAACAATGAAGATCATCAACTAGATCGCTTTAAAGTGAAGGAAGTG CAGTGCATAAACTGTGAAAAAATTCAACATGCCCAACAGACTTGTGAAGAATGTAGCACA TTGTTTGGAGAATATTATTGCGATATATGCCATTTGTTTGACAAAGATAAGAAGCAGTAT CACTGTGAAAACTGTGGAATTTGTAGGATTGGTCCAAAGGAAGATTTTTTCCATTGTTTG AAATGTAACTTATGCCTAGCTATGAATCTTCAAGGAAGACACAAGTGTATTGAAAATGTG TCCCGACAGAATTGTCCAATATGTTTGGAGGACATTCACACATCCCGTGTTGTTGCTCAT GTCTTGCCATGTGGACATCTTTTACATAGAGGCTACAGATGTCCATTATGTATGCACTCT GCTTTAGATATGACCAGGTATTGGAGACAGCTGGATGATGAAGTAGCACAGACTCCTATG CCATCAGAATATCAGAACATGACTGTGGATATTCTCTGCAATGACTGTAATGGACGATCC ACTGTTCAGTTTCATATATTAGGCATGAAATGTAAGATTTGTGAATCCTATAATACTGCT CAAGCTGGAGGACGTAGAATTTCACTGGATCAGCAATGA |
Restriction Sites | Please inquire |
ACCN | NM_001009922 |
ORF Size | 759 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001009922.1, NP_001009922.1 |
RefSeq Size | 4309 |
RefSeq ORF | 759 |
Locus ID | 25898 |
Protein Families | Druggable Genome, Stem cell - Pluripotency |
Protein Pathways | p53 signaling pathway, Ubiquitin mediated proteolysis |
Gene Summary | The protein encoded by this gene has ubiquitin ligase activity. It mediates E3-dependent ubiquitination and proteasomal degradation of target proteins, including tumor protein 53, histone deacetylase 1, and cyclin-dependent kinase inhibitor 1B, thus regulating their levels and cell cycle progression. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jun 2013] Transcript Variant: This variant (3) lacks an in-frame exon in the internal coding region, compared to variant 1. The encoded isoform (3, also known as Pirh2B) is shorter, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219130 | RCHY1 (Myc-DDK-tagged)-Human ring finger and CHY zinc finger domain containing 1 (RCHY1), transcript variant 3 |
USD 420.00 |
|
RG219130 | RCHY1 (GFP-tagged) - Human ring finger and CHY zinc finger domain containing 1 (RCHY1), transcript variant 3 |
USD 460.00 |
|
RC219130L3 | Lenti-ORF clone of RCHY1 (Myc-DDK-tagged)-Human ring finger and CHY zinc finger domain containing 1 (RCHY1), transcript variant 3 |
USD 620.00 |
|
RC219130L4 | Lenti-ORF clone of RCHY1 (mGFP-tagged)-Human ring finger and CHY zinc finger domain containing 1 (RCHY1), transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review