RIPPLY2 (NM_001009994) Human Untagged Clone

CAT#: SC301467

RIPPLY2 (untagged)-Human ripply2 homolog (zebrafish) (RIPPLY2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RIPPLY2
• Synonyms: C6orf159; dJ237I15.1; SCDO6
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001009994, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGAACGCGGGAGGCGCAGAGGGTACAGAGAGTGGAGCTGCGGCGTGCGCGGCCACCGACGGCCCTA
  CGCGGCGCGCGGGCGCGGACTCCGGATACGCAGGCTTCTGGAGACCCTGGGTGGACGCCGGAGGCAAGAA
  AGAAGAGGAGACGCCGAACCACGCCGCGGAGGCGATGCCCGATGGCCCTGGAATGACCGCAGCCTCAGGA
  AAGCTTTACCAATTCAGGCACCCAGTCAGACTATTTTGGCCAAAATCAAAATGTTATGATTACTTATATC
  AAGAAGCAGAAGCTCTTCTGAAAAATTTTCCAATTCAAGCCACAATTTCATTTTATGAAGATTCTGATAG
  CGAAGATGAAATTGAGGATCTGACCTGTGAAAATTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001009994
• ORF Size: 387 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001009994.2, NP_001009994.1
• RefSeq Size: 674
• RefSeq ORF: 387
• Locus ID: 134701
• Gene Summary: This gene encodes a nuclear protein that belongs to a novel family of proteins required for vertebrate somitogenesis. Members of this family have a tetrapeptide WRPW motif that is required for interaction with the transcriptional repressor Groucho and a carboxy-terminal Ripply homology domain/Bowline-DSCR-Ledgerline conserved region required for transcriptional repression. Null mutant mice die soon after birth and display defects in axial skeleton segmentation due to defective somitogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the protein.