HES5 (NM_001010926) Human Untagged Clone

CAT#: SC301536

HES5 (untagged)-Human hairy and enhancer of split 5 (Drosophila) (HES5)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HES5
• Synonyms: bHLHb38
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_001010926 edited
  ATGGCCCCCAGCACTGTGGCCGTGGAGCTGCTCAGCCCCAAAGAGAAAAACCGACTGCGG
  AAGCCGGTGGTGGAGAAGATGCGCCGCGACCGCATCAACAGCAGCATCGAGCAGCTGAAG
  CTGCTGCTGGAGCAGGAGTTCGCGCGGCACCAGCCCAACTCCAAGCTGGAGAAGGCCGAC
  ATCCTGGAGATGGCTGTCAGCTACCTGAAGCACAGCAAAGCCTTCGTCGCCGCCGCCGGC
  CCCAAGAGCCTGCACCAGGACTACAGCGAAGGCTACTCGTGGTGCCTGCAGGAGGCCGTG
  CAGTTCCTGACGCTCCACGCCGCCAGCGACACGCAGATGAAGCTGCTGTACCACTTCCAG
  CGGCCCCCGGCCGCGCCCGCCGCGCCCGCCAAGGAGCCCAAGGCGCCGGGCGCCGCGCCC
  CCGCCCGCGCTCTCCGCCAAGGCCACCGCCGCCGCCGCCGCCGCGCACCAGCCCGCCTGC
  GGCCTCTGGCGGCCCTGGTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001010926
• ORF Size: 501 bp
• Insert Size: 1300
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001010926.1.

Reference Data

• RefSeq: NM_001010926.1, NP_001010926.1
• RefSeq Size: 1306
• RefSeq ORF: 501
• Locus ID: 388585
• Protein Families: Druggable Genome, ES Cell Differentiation/IPS
• Protein Pathways: Notch signaling pathway
• Gene Summary: This gene encodes a member of a family of basic helix-loop-helix transcriptional repressors. The protein product of this gene, which is activated downstream of the Notch pathway, regulates cell differentiation in multiple tissues. Disruptions in the normal expression of this gene have been associated with developmental diseases and cancer. [provided by RefSeq, Dec 2008]