HES5 (NM_001010926) Human Untagged Clone
CAT#: SC301536
HES5 (untagged)-Human hairy and enhancer of split 5 (Drosophila) (HES5)
"NM_001010926" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | HES5 |
| Synonyms | bHLHb38 |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001010926 edited
ATGGCCCCCAGCACTGTGGCCGTGGAGCTGCTCAGCCCCAAAGAGAAAAACCGACTGCGG AAGCCGGTGGTGGAGAAGATGCGCCGCGACCGCATCAACAGCAGCATCGAGCAGCTGAAG CTGCTGCTGGAGCAGGAGTTCGCGCGGCACCAGCCCAACTCCAAGCTGGAGAAGGCCGAC ATCCTGGAGATGGCTGTCAGCTACCTGAAGCACAGCAAAGCCTTCGTCGCCGCCGCCGGC CCCAAGAGCCTGCACCAGGACTACAGCGAAGGCTACTCGTGGTGCCTGCAGGAGGCCGTG CAGTTCCTGACGCTCCACGCCGCCAGCGACACGCAGATGAAGCTGCTGTACCACTTCCAG CGGCCCCCGGCCGCGCCCGCCGCGCCCGCCAAGGAGCCCAAGGCGCCGGGCGCCGCGCCC CCGCCCGCGCTCTCCGCCAAGGCCACCGCCGCCGCCGCCGCCGCGCACCAGCCCGCCTGC GGCCTCTGGCGGCCCTGGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001010926 |
| ORF Size | 501 bp |
| Insert Size | 1300 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001010926.1. |
| Reference Data | |
| RefSeq | NM_001010926.1, NP_001010926.1 |
| RefSeq Size | 1306 |
| RefSeq ORF | 501 |
| Locus ID | 388585 |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS |
| Protein Pathways | Notch signaling pathway |
| Gene Summary | This gene encodes a member of a family of basic helix-loop-helix transcriptional repressors. The protein product of this gene, which is activated downstream of the Notch pathway, regulates cell differentiation in multiple tissues. Disruptions in the normal expression of this gene have been associated with developmental diseases and cancer. [provided by RefSeq, Dec 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215311 | HES5 (Myc-DDK-tagged)-Human hairy and enhancer of split 5 (Drosophila) (HES5) |
USD 150.00 |
|
| RG215311 | HES5 (GFP-tagged) - Human hairy and enhancer of split 5 (Drosophila) (HES5) |
USD 460.00 |
|
| RC215311L1 | Lenti ORF clone of Human hairy and enhancer of split 5 (Drosophila) (HES5), Myc-DDK-tagged |
USD 768.00 |
|
| RC215311L2 | Lenti ORF clone of Human hairy and enhancer of split 5 (Drosophila) (HES5), mGFP tagged |
USD 620.00 |
|
| RC215311L3 | Lenti ORF clone of Human hairy and enhancer of split 5 (Drosophila) (HES5), Myc-DDK-tagged |
USD 620.00 |
|
| RC215311L4 | Lenti ORF clone of Human hairy and enhancer of split 5 (Drosophila) (HES5), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China