HERPUD1 (NM_001010990) Human Untagged Clone

CAT#: SC301563

HERPUD1 (untagged)-Human homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 (HERPUD1), transcript variant 3


  "NM_001010990" in other vectors (4)

Reconstitution Protocol

USD 630.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "HERPUD1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HERPUD1
Synonyms HERP; Mif1; SUP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001010990, the custom clone sequence may differ by one or more nucleotides


ATGGAGTCCGAGACCGAACCCGAGCCCGTCACGCTCCTGGTGAAGAGCCCCAACCAGCGCCACCGCGACT
TGGAGCTGAGTGGCGACCGCGGCTGGAGTGTGGGCCACCTCAAGGCCCACCTGAGCCGCGTCTACCCCGA
GCGTCCGCGTCCAGAGGACCAGAGGTTAATTTATTCTGGGAAGCTGTTGTTGGATCACCAATGTCTCAGG
GACTTGCTTCCAAAGGTGGCTGAATCCACAGAGGAGCCTGCTGGTTCTAATCGGGGACAGTATCCTGAGG
ATTCCTCAAGTGATGGTTTAAGGCAAAGGGAAGTTCTTCGGAACCTTTCTTCCCCTGGATGGGAAAACAT
CTCAAGGCCTGAAGCTGCCCAGCAGGCATTCCAAGGCCTGGGTCCTGGTTTCTCCGGTTACACACCCTAT
GGGTGGCTTCAGCTTTCCTGGTTCCAGCAGATATATGCACGACAGTACTACATGCAATATTTAGCAGCCA
CTGCTGCATCAGGGGCTTTTGTTCCACCACCAAGTGCACAAGAGATACCTGTGGTCTCTGCACCTGCTCC
AGCCCCTATTCACAACCAGTTTCCAGCTGAAAACCAGCCTGCCAATCAGAATGCTGCTCCTCAAGTGGTT
GTTAATCCTGGAGCCAATCAAAATTTGCGGATGAATGCACAAGGTGGCCCTATTGTGGAAGAAGATGATG
AAATAAATCGAGATTGGTTGGATTGGACCTATTCAGCAGCTACATTTTCTGTTTTTCTCAGTATCCTCTA
CTTCTACTCCTCCCTGAGCAGATTCCTCATGGTCATGGGGGCCACCGTTGTTATGTACCTGCATCACGTT
GGGTGGTTTCCATTTAGACCGAGGCCGGTTCAGAACTTCCCAAATGATGGTCCTCCTCCTGACGTTGTAA
ATCAGGACCCCAACAATAACTTACAGGAAGGCACTGATCCTGAAACTGAAGACCCCAACCACCTCCCTCC
AGACAGGGATGTACTAGATGGCGAGCAGACCAGCCCCTCCTTTATGAGCACAGCATGGCTTGTCTTCAAG
ACTTTCTTTGCCTCTCTTCTTCCAGAAGGCCCCCCAGCCATCGCAAACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001010990
ORF Size 1101 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001010990.1, NP_001010990.1
RefSeq Size 2123
RefSeq ORF 1101
Locus ID 9709
Protein Families Druggable Genome
Gene Summary The accumulation of unfolded proteins in the endoplasmic reticulum (ER) triggers the ER stress response. This response includes the inhibition of translation to prevent further accumulation of unfolded proteins, the increased expression of proteins involved in polypeptide folding, known as the unfolded protein response (UPR), and the destruction of misfolded proteins by the ER-associated protein degradation (ERAD) system. This gene may play a role in both UPR and ERAD. Its expression is induced by UPR and it has an ER stress response element in its promoter region while the encoded protein has an N-terminal ubiquitin-like domain which may interact with the ERAD system. This protein has been shown to interact with presenilin proteins and to increase the level of amyloid-beta protein following its overexpression. Alternative splicing of this gene produces multiple transcript variants encoding different isoforms. The full-length nature of all transcript variants has not been determined. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (3) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform 3) that has a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.