C1GALT1C1 (NM_001011551) Human Untagged Clone

CAT#: SC301579

C1GALT1C1 (untagged)-Human C1GALT1-specific chaperone 1 (C1GALT1C1), transcript variant 2


  "NM_001011551" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "C1GALT1C1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol C1GALT1C1
Synonyms C1GALT2; C38H2-L1; COSMC; HSPC067; MST143; TNPS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001011551, the custom clone sequence may differ by one or more nucleotides


ATGCTTTCTGAAAGCAGCTCCTTTTTGAAGGGTGTGATGCTTGGAAGCATTTTCTGTGCTTTGATCACTA
TGCTAGGACACATTAGGATTGGTCATGGAAATAGAATGCACCACCATGAGCATCATCACCTACAAGCTCC
TAACAAAGAAGATATCTTGAAAATTTCAGAGGATGAGCGCATGGAGCTCAGTAAGAGCTTTCGAGTATAC
TGTATTATCCTTGTAAAACCCAAAGATGTGAGTCTTTGGGCTGCAGTAAAGGAGACTTGGACCAAACACT
GTGACAAAGCAGAGTTCTTCAGTTCTGAAAATGTTAAAGTGTTTGAGTCAATTAATATGGACACAAATGA
CATGTGGTTAATGATGAGAAAAGCTTACAAATACGCCTTTGATAAGTATAGAGACCAATACAACTGGTTC
TTCCTTGCACGCCCCACTACGTTTGCTATCATTGAAAACCTAAAGTATTTTTTGTTAAAAAAGGATCCAT
CACAGCCTTTCTATCTAGGCCACACTATAAAATCTGGAGACCTTGAATATGTGGGTATGGAAGGAGGAAT
TGTCTTAAGTGTAGAATCAATGAAAAGACTTAACAGCCTTCTCAATATCCCAGAAAAGTGTCCTGAACAG
GGAGGGATGATTTGGAAGATATCTGAAGATAAACAGCTAGCAGTTTGCCTGAAATATGCTGGAGTATTTG
CAGAAAATGCAGAAGATGCTGATGGAAAAGATGTATTTAATACCAAATCTGTTGGGCTTTCTATTAAAGA
GGCAATGACTTATCACCCCAACCAGGTAGTAGAAGGCTGTTGTTCAGATATGGCTGTTACTTTTAATGGA
CTGACTCCAAATCAGATGCATGTGATGATGTATGGGGTATACCGCCTTAGGGCATTTGGGCATATTTTCA
ATGATGCATTGGTTTTCTTACCTCCAAATGGTTCTGACAATGACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001011551
ORF Size 957 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001011551.2, NP_001011551.1
RefSeq Size 1743
RefSeq ORF 957
Locus ID 29071
Protein Families Transmembrane
Protein Pathways Metabolic pathways, O-Glycan biosynthesis
Gene Summary This gene encodes a type II transmembrane protein that is similar to the core 1 beta1,3-galactosyltransferase 1, which catalyzes the synthesis of the core-1 structure, also known as Thomsen-Friedenreich antigen, on O-linked glycans. This gene product lacks the galactosyltransferase activity itself, but instead acts as a molecular chaperone required for the folding, stability and full activity of the core 1 beta1,3-galactosyltransferase 1. Mutations in this gene have been associated with Tn syndrome. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Dec 2009]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.