C1GALT1C1 (NM_001011551) Human Untagged Clone
CAT#: SC301579
C1GALT1C1 (untagged)-Human C1GALT1-specific chaperone 1 (C1GALT1C1), transcript variant 2
"NM_001011551" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | C1GALT1C1 |
Synonyms | C1GALT2; C38H2-L1; COSMC; HSPC067; MST143; TNPS |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001011551, the custom clone sequence may differ by one or more nucleotides
ATGCTTTCTGAAAGCAGCTCCTTTTTGAAGGGTGTGATGCTTGGAAGCATTTTCTGTGCTTTGATCACTA TGCTAGGACACATTAGGATTGGTCATGGAAATAGAATGCACCACCATGAGCATCATCACCTACAAGCTCC TAACAAAGAAGATATCTTGAAAATTTCAGAGGATGAGCGCATGGAGCTCAGTAAGAGCTTTCGAGTATAC TGTATTATCCTTGTAAAACCCAAAGATGTGAGTCTTTGGGCTGCAGTAAAGGAGACTTGGACCAAACACT GTGACAAAGCAGAGTTCTTCAGTTCTGAAAATGTTAAAGTGTTTGAGTCAATTAATATGGACACAAATGA CATGTGGTTAATGATGAGAAAAGCTTACAAATACGCCTTTGATAAGTATAGAGACCAATACAACTGGTTC TTCCTTGCACGCCCCACTACGTTTGCTATCATTGAAAACCTAAAGTATTTTTTGTTAAAAAAGGATCCAT CACAGCCTTTCTATCTAGGCCACACTATAAAATCTGGAGACCTTGAATATGTGGGTATGGAAGGAGGAAT TGTCTTAAGTGTAGAATCAATGAAAAGACTTAACAGCCTTCTCAATATCCCAGAAAAGTGTCCTGAACAG GGAGGGATGATTTGGAAGATATCTGAAGATAAACAGCTAGCAGTTTGCCTGAAATATGCTGGAGTATTTG CAGAAAATGCAGAAGATGCTGATGGAAAAGATGTATTTAATACCAAATCTGTTGGGCTTTCTATTAAAGA GGCAATGACTTATCACCCCAACCAGGTAGTAGAAGGCTGTTGTTCAGATATGGCTGTTACTTTTAATGGA CTGACTCCAAATCAGATGCATGTGATGATGTATGGGGTATACCGCCTTAGGGCATTTGGGCATATTTTCA ATGATGCATTGGTTTTCTTACCTCCAAATGGTTCTGACAATGACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001011551 |
ORF Size | 957 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001011551.2, NP_001011551.1 |
RefSeq Size | 1743 |
RefSeq ORF | 957 |
Locus ID | 29071 |
Protein Families | Transmembrane |
Protein Pathways | Metabolic pathways, O-Glycan biosynthesis |
Gene Summary | This gene encodes a type II transmembrane protein that is similar to the core 1 beta1,3-galactosyltransferase 1, which catalyzes the synthesis of the core-1 structure, also known as Thomsen-Friedenreich antigen, on O-linked glycans. This gene product lacks the galactosyltransferase activity itself, but instead acts as a molecular chaperone required for the folding, stability and full activity of the core 1 beta1,3-galactosyltransferase 1. Mutations in this gene have been associated with Tn syndrome. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Dec 2009] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222615 | C1GALT1C1 (Myc-DDK-tagged)-Human C1GALT1-specific chaperone 1 (C1GALT1C1), transcript variant 2 |
USD 420.00 |
|
RG222615 | C1GALT1C1 (GFP-tagged) - Human C1GALT1-specific chaperone 1 (C1GALT1C1), transcript variant 2 |
USD 460.00 |
|
RC222615L3 | Lenti ORF clone of Human C1GALT1-specific chaperone 1 (C1GALT1C1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC222615L4 | Lenti ORF clone of Human C1GALT1-specific chaperone 1 (C1GALT1C1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review