BIRC5 (NM_001012270) Human Untagged Clone
CAT#: SC301617
BIRC5 (untagged)-Human baculoviral IAP repeat containing 5 (BIRC5/Survivin), transcript variant 2
"NM_001012270" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BIRC5 |
Synonyms | API4; EPR-1 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001012270 edited
ATGGGTGCCCCGACGTTGCCCCCTGCCTGGCAGCCCTTTCTCAAGGACCACCGCATCTCT ACATTCAAGAACTGGCCCTTCTTGGAGGGCTGCGCCTGCACCCCGGAGCGGATGGCCGAG GCTGGCTTCATCCACTGCCCCACTGAGAACGAGCCAGACTTGGCCCAGTGTTTCTTCTGC TTCAAGGAGCTGGAAGGCTGGGAGCCAGATGACGACCCCATGCAAAGGAAACCAACAATA AGAAGAAAGAATTTGAGGAAACTGCGGAGAAAGTGCGCCGTGCCATCGAGCAGCTGGCTG CCATGGATTGAGGCCTCTGGCCGGAGCTGCCTGGTCCCAGAGTGGCTGCACCACTTCCAG GGTTTATTCCCTGGTGCCACCAGCCTTCCTGTGGGCCCCTTAGCAATGTCTTAG |
Restriction Sites | Please inquire |
ACCN | NM_001012270 |
Insert Size | 2800 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001012270.1. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001012270.1, NP_001012270.1 |
RefSeq Size | 2537 bp |
RefSeq ORF | 414 bp |
Locus ID | 332 |
Cytogenetics | 17q25.3 |
Protein Families | Druggable Genome, Stem cell - Pluripotency |
Protein Pathways | Colorectal cancer, Pathways in cancer |
Gene Summary | 'This gene is a member of the inhibitor of apoptosis (IAP) gene family, which encode negative regulatory proteins that prevent apoptotic cell death. IAP family members usually contain multiple baculovirus IAP repeat (BIR) domains, but this gene encodes proteins with only a single BIR domain. The encoded proteins also lack a C-terminus RING finger domain. Gene expression is high during fetal development and in most tumors, yet low in adult tissues. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2011]' Transcript Variant: This variant (2), also known as survivin-deltaEx3, lacks an exon in the 3' coding region which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus when it is compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212205 | BIRC5 (Myc-DDK-tagged)-Human baculoviral IAP repeat containing 5 (BIRC5/Survivin), transcript variant 2 |
USD 98.00 |
|
RG212205 | BIRC5 (GFP-tagged) - Human baculoviral IAP repeat containing 5 (BIRC5/Survivin), transcript variant 2 |
USD 460.00 |
|
RC212205L3 | Lenti ORF clone of Human baculoviral IAP repeat containing 5 (BIRC5), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC212205L4 | Lenti ORF clone of Human baculoviral IAP repeat containing 5 (BIRC5), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review