CRLF2 (NM_001012288) Human Untagged Clone

CAT#: SC301624

CRLF2 (untagged)-Human cytokine receptor-like factor 2 (CRLF2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CRLF2
• Synonyms: CRL2; CRLF2Y; TSLPR
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001012288 edited
  AACGGTGATGAGGCCTATGACCAGTGCACCAACTACCTTCTCCAGGAAGGTCACACTTCG
  GGGTGCCTCCTAGACGCAGAGCAGCGAGACGACATTCTCTATTTCTCCATCAGGAATGGG
  ACGCACCCCGTTTTCACCGCAAGTCGCTGGATGGTTTATTACCTGAAACCCAGTTCCCCG
  AAGCACGTGAGATTTTCGTGGCATCAGGATGCAGTGACGGTGACGTGTTCTGACCTGTCC
  TACGGGGATCTCCTCTATGAGGTTCAGTACCGGAGCCCCTTCGACACCGAGTGGCAGTCC
  AAACAGGAAAATACCTGCAACGTCACCATAGAAGGCTTGGATGCCGAGAAGTGTTACTCT
  TTCTGGGTCAGGGTGAAGGCTATGGAGGATGTATATGGGCCAGACACATACCCAAGCGAC
  TGGTCAGAGGTGACATGCTGGCAGAGAGGCGAGATTCGGGATGCCTGTGCAGAGACACCA
  ACGCCTCCCAAACCAAAGCTGTCCAAATTTATTTTAATTTCCAGCCTGGCCATCCTTCTG
  ATGGTGTCTCTCCTCCTTCTGTCTTTATGGAAATTATGGAGAGTGAGGAAGTTTCTCATT
  CCCAGCGTGCCAGACCCGAAATCCATCTTCCCCGGGCTCTTTGAGATACACCAAGGGAAC
  TTCCAGGAGTGGATCACAGACACCCAGAACGTGGCCCACCTCCACAAGATGGCAGGTGCA
  GAGCAAGGAAGTGGCCCCGAGGAGCCCCTGGTAGTCCAGTTGGCCAAGACTGAAGCCGAG
  TCTCCCAGGATGCTGGACCCACAGACCGAGGAGAAAGAGGCCTCTGGGGGATCCCTCCAG
  CTTCCCCACCAGCCCCTCCAAGGCGGTGATGTGGTCACAATCGGGGGCTTCACCTTTGTG
  ATGAATGACCGCTCCTACGTGGCGTTGTGATCTAGATTG
  
• Restriction Sites: Please inquire
• ACCN: NM_001012288
• Insert Size: 930 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_001012288.1.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001012288.1, NP_001012288.1
• RefSeq Size: 1013 bp
• RefSeq ORF: 780 bp
• Locus ID: 64109
• Cytogenetics: Xp22.33 and Yp11.2
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Protein Pathways: Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
• Gene Summary: This gene encodes a member of the type I cytokine receptor family. The encoded protein is a receptor for thymic stromal lymphopoietin (TSLP). Together with the interleukin 7 receptor (IL7R), the encoded protein and TSLP activate STAT3, STAT5, and JAK2 pathways, which control processes such as cell proliferation and development of the hematopoietic system. Rearrangement of this gene with immunoglobulin heavy chain gene (IGH) on chromosome 14, or with P2Y purinoceptor 8 gene (P2RY8) on the same X or Y chromosomes is associated with B-progenitor acute lymphoblastic leukemia (ALL) and Down syndrome ALL. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
  Transcript Variant: This variant (2) lacks an alternate exon which results in translation initiation at a downstream start codon compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1.