CTNNBIP1 (NM_001012329) Human Untagged Clone

CAT#: SC301631

CTNNBIP1 (untagged)-Human catenin, beta interacting protein 1 (CTNNBIP1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CTNNBIP1
• Synonyms: ICAT
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001012329, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAACCGCGAGGGAGCTCCCGGGAAGAGTCCGGAGGAGATGTACATTCAGCAGAAGGTCCGAGTGCTGC
  TCATGCTGCGGAAGATGGGATCAAACCTGACAGCCAGCGAGGAGGAGTTCCTGCGCACCTATGCAGGGGT
  GGTCAACAGCCAGCTCAGCCAGCTGCCTCCGCACTCCATCGACCAGGGTGCAGAGGACGTGGTGATGGCG
  TTTTCCAGGTCGGAGACGGAAGACCGGAGGCAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001012329
• ORF Size: 246 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001012329.1, NP_001012329.1
• RefSeq Size: 2961
• RefSeq ORF: 246
• Locus ID: 56998
• Protein Families: Druggable Genome, Transcription Factors
• Protein Pathways: Wnt signaling pathway
• Gene Summary: The protein encoded by this gene binds CTNNB1 and prevents interaction between CTNNB1 and TCF family members. The encoded protein is a negative regulator of the Wnt signaling pathway. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein.