Shugoshin (SGO1) (NM_001012413) Human Untagged Clone
CAT#: SC301645
SGOL1 (untagged)-Human shugoshin-like 1 (S. pombe) (SGOL1), transcript variant C1
"NM_001012413" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SGO1 |
Synonyms | CAID; NY-BR-85; SGO; SGOL1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001012413, the custom clone sequence may differ by one or more nucleotides
ATGGCCAAGGAAAGATGCCTGAAAAAGTCCTTTCAAGATAGTCTTGAAGACATAAAGAAGCGAATGAAAG AGAAAAGGAATAAAAACTTGGCAGAGATTGGCAAACGCAGGTCTTTTATAGCTGCACCATGCCAAATAAT CACCAACACTTCTACACTGCTGAAAAATTACCAAGACAACAACAAAATGTTAGTTTTAGCTTTGGAAAAT GAAAAATCCAAAGTGAAAGAAGCCCAAGATATCATCCTACAGCTGAGAAAAGAATGTTACTATCTCACAT GTCAGCTATATGCATTGAAAGGAAAACTTACATCACAACAAACAGTAGAACCTGCTCAGAACCAGGAAAT ATGTTCCTCTGGAATGGACCCCAATAGTGATGACAGCTCCAGAAATTTATTTGTGAAGGATTTACCGCAA ATTCCTCTTGAAGAAACTGAACTTCCAGGACAAGGAGAATCATTTCAAATAGAAGCTACACCACCTGAAA CTCAGCAGTCACCTCATCTTAGCCTGAAGGATATCACCAATGTCTCCTTGTATCCTGTTGTGAAAATCAG AAGACTTTCTCTTTCTCCAAAAAAGAATAAAGCAAGCCCAGCAGTGGCTCTGCCTAAACGTAGGTGCACA GCCAGCGTGAACTATAAGGAGCCCACCCTCGCTTCGAAACTGAGAAGAGGGGACCCTTTTACAGATTTGT GTTTTTTGAATTCTCCTATTTTCAAGCAGAAAAAGGATTTGAGACGTTCTAAAAAAAGTATGAAACAAAT ACAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001012413 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001012413.3, NP_001012413.1 |
RefSeq Size | 2197 bp |
RefSeq ORF | 777 bp |
Locus ID | 151648 |
Cytogenetics | 3p24.3 |
Protein Pathways | Oocyte meiosis |
Gene Summary | The protein encoded by this gene is a member of the shugoshin family of proteins. This protein is thought to protect centromeric cohesin from cleavage during mitotic prophase by preventing phosphorylation of a cohesin subunit. Reduced expression of this gene leads to the premature loss of centromeric cohesion, mis-segregation of sister chromatids, and mitotic arrest. Evidence suggests that this protein also protects a small subset of cohesin found along the length of the chromosome arms during mitotic prophase. An isoform lacking exon 6 has been shown to play a role in the cohesion of centrioles (PMID: 16582621 and PMID:18331714). Mutations in this gene have been associated with Chronic Atrial and Intestinal Dysrhythmia (CAID) syndrome, characterized by the co-occurrence of Sick Sinus Syndrome (SSS) and Chronic Intestinal Pseudo-obstruction (CIPO) within the first four decades of life (PMID:25282101). Fibroblast cells from CAID patients exhibited both increased cell proliferation and higher rates of senescence. Pseudogenes of this gene have been found on chromosomes 1 and 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015] Transcript Variant: This variant (Sgo1B, PMID:15737064; also known as C1) differs in its 5' UTR and lacks an alternate in-frame exon in its central coding region compared to variant 1. It encodes isoform 1AB which is shorter and has a distinct internal amino acid, compared to isoform 1. Both variants Sgo1A and Sgo1B encode the same isoform (1AB). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216188 | SGOL1 (Myc-DDK-tagged)-Human shugoshin-like 1 (S. pombe) (SGOL1), transcript variant C1 |
USD 98.00 |
|
RG216188 | SGOL1 (GFP-tagged) - Human shugoshin-like 1 (S. pombe) (SGOL1), transcript variant C1 |
USD 460.00 |
|
RC216188L3 | Lenti ORF clone of Human shugoshin-like 1 (S. pombe) (SGOL1), transcript variant C1, Myc-DDK-tagged |
USD 620.00 |
|
RC216188L4 | Lenti ORF clone of Human shugoshin-like 1 (S. pombe) (SGOL1), transcript variant C1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review