Gastrin Releasing Peptide (GRP) (NM_001012512) Human Untagged Clone

CAT#: SC301674

GRP (untagged)-Human gastrin-releasing peptide (GRP), transcript variant 2


  "NM_001012512" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GRP
Synonyms BN; GRP-10; preproGRP; proGRP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001012512 edited
CCAGCGGCTGCGGCGGCGGAGCTCCTCCGAGGTCCGGGTCACCAGTCTCTGCTCTTCCCA
GCCTCTCCGGCGCGCTCCAAGGGCTTCCCGTCGGGACCATGCGCGGCCGTGAGCTCCCGC
TGGTCCTGCTGGCGCTGGTCCTCTGCCTGGCGCCCCGGGGGCGAGCGGTCCCGCTGCCTG
CGGGCGGAGGGACCGTGCTGACCAAGATGTACCCGCGCGGCAACCACTGGGCGGTGGGGC
ACTTAATGGGGAAAAAGAGCACAGGGGAGTCTTCTTCTGTTTCTGAGAGAGGGAGCCTGA
AGCAGCAGCTGAGAGAGTACATCAGGTGGGAAGAAGCTGCAAGGAATTTGCTGGGTCTCA
TAGAAGCAAAGGAGAACAGAAACCACCAGCCACCTCAACCCAAGGCCCTGGGCAATCAGC
AGCCTTCGTGGGATTCAGAGGATAGCAGCAACTTCAAAGATGTAGGTTCAAAAGGCAAAG
GTTCTCAACGTGAAGGAAGGAACCCCCAGCTGAACCAGCAATGATAATGATGGCCTCTCT
CAAAAGAGAAAAACAAAACCCCTAAGAGACTGCGTTCTGCAAGCATCAGTTCTACGGATC
ATCAACAAGATTTCCTTGTGCAAAATATTTGACTATTCTGTATCTTTCATCCTTGACTAA
ATTCGTGATTTTCAAGCAGCATCTTCTGGTTTAAACTTGTTTGCTGTGAACAATTGTCGA
AAAGAGTCTTCCAATTAATGCTTTTTTATATCTAGGCTACCTGTTGGTTAGATTCAAGGC
CCCGAGCTGTTACCATTCACAATAAAAGCTTAAACACATTGTCCAAAAAAAAAAAAAAAA
AA
Restriction Sites Please inquire     
ACCN NM_001012512
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001012512.1.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001012512.1, NP_001012530.1
RefSeq Size 842 bp
RefSeq ORF 426 bp
Locus ID 2922
Cytogenetics 18q21.32
Protein Families Secreted Protein
Gene Summary 'This gene encodes a member of the bombesin-like family of gastrin-releasing peptides. The encoded preproprotein is proteolytically processed to generate two peptides, gastrin-releasing peptide and neuromedin-C. These peptides regulate numerous functions of the gastrointestinal and central nervous systems, including release of gastrointestinal hormones, smooth muscle cell contraction, and epithelial cell proliferation. These peptides are also likely to play a role in human cancers of the lung, colon, stomach, pancreas, breast, and prostate. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]'
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1, resulting in a shorter protein (isoform 2). This variant has also been identified as 'splice isoform 3' and 'pro-gastrin releasing peptide type 2'. The encoded isoform (2) may undergo proteolytic processing similar to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.