AGPAT2 (NM_001012727) Human Untagged Clone
CAT#: SC301710
AGPAT2 (untagged)-Human 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) (AGPAT2), transcript variant 2
"NM_001012727" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | AGPAT2 |
Synonyms | 1-AGPAT2; BSCL; BSCL1; LPAAB; LPAAT-beta |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001012727, the custom clone sequence may differ by one or more nucleotides
ATGGAGCTGTGGCCGTGTCTGGCCGCGGCGCTGCTGTTGCTGCTGCTGCTGGTGCAGCTGAGCCGCGCGG CCGAGTTCTACGCCAAGGTCGCCCTGTACTGCGCGCTGTGCTTCACGGTGTCCGCCGTGGCCTCGCTCGT CTGCCTGCTGCGCCACGGCGGCCGGACGGTGGAGAACATGAGCATCATCGGCTGGTTCGTGCGAAGCTTC AAGTACTTTTACGGGCTCCGCTTCGAGGTGCGGGACCCGCGCAGGCTGCAGGAGGCCCGTCCCTGTGTCA TCGTCTCCAACCACCAGAGCATCCTGGACATGATGGGCCTCATGGAGGTCCTTCCGGAGCGCTGCGTGCA GATCGCCAAGCGGGAGCTGCTCTTCCTGGGGCCCGTGGGCCTCATCATGTACCTCGGGGGCGTCTTCTTC ATCAACCGGCAGCGCTCTAGCACTGCCATGACAGTGATGGCCGACCTGGGCGAGCGCATGGTCAGGGAGA ACGTGCCCATCGTCCCCGTGGTGTACTCTTCCTTCTCCTCCTTCTACAACACCAAGAAGAAGTTCTTCAC TTCAGGAACAGTCACAGTGCAGGTGCTGGAAGCCATCCCCACCAGCGGCCTCACTGCGGCGGACGTCCCT GCGCTCGTGGACACCTGCCACCGGGCCATGAGGACCACCTTCCTCCACATCTCCAAGACCCCCCAGGAGA ACGGGGCCACTGCGGGGTCTGGCGTGCAGCCGGCCCAGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001012727 |
ORF Size | 741 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001012727.1, NP_001012745.1 |
RefSeq Size | 1480 |
RefSeq ORF | 741 |
Locus ID | 10555 |
Protein Families | Transmembrane |
Protein Pathways | Ether lipid metabolism, Glycerolipid metabolism, Glycerophospholipid metabolism, Metabolic pathways |
Gene Summary | This gene encodes a member of the 1-acylglycerol-3-phosphate O-acyltransferase family. The protein is located within the endoplasmic reticulum membrane and converts lysophosphatidic acid to phosphatidic acid, the second step in de novo phospholipid biosynthesis. Mutations in this gene have been associated with congenital generalized lipodystrophy (CGL), or Berardinelli-Seip syndrome, a disease characterized by a near absence of adipose tissue and severe insulin resistance. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform b). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200622 | AGPAT2 (Myc-DDK-tagged)-Human 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) (AGPAT2), transcript variant 2 |
USD 98.00 |
|
RG200622 | AGPAT2 (GFP-tagged) - Human 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) (AGPAT2), transcript variant 2 |
USD 460.00 |
|
RC200622L3 | Lenti ORF clone of Human 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) (AGPAT2), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC200622L4 | Lenti ORF clone of Human 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) (AGPAT2), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review