AKT1 (NM_001014432) Human Untagged Clone
CAT#: SC301930
AKT1 (untagged)-Human v-akt murine thymoma viral oncogene homolog 1 (AKT1), transcript variant 2
"NM_001014432" in other vectors (4)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | AKT1 |
| Synonyms | AKT; PKB; PKB-ALPHA; PRKBA; RAC; RAC-ALPHA |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001014432, the custom clone sequence may differ by one or more nucleotides
ATGAGCGACGTGGCTATTGTGAAGGAGGGTTGGCTGCACAAACGAGGGGAGTACATCAAGACCTGGCGGC CACGCTACTTCCTCCTCAAGAATGATGGCACCTTCATTGGCTACAAGGAGCGGCCGCAGGATGTGGACCA ACGTGAGGCTCCCCTCAACAACTTCTCTGTGGCGCAGTGCCAGCTGATGAAGACGGAGCGGCCCCGGCCC AACACCTTCATCATCCGCTGCCTGCAGTGGACCACTGTCATCGAACGCACCTTCCATGTGGAGACTCCTG AGGAGCGGGAGGAGTGGACAACCGCCATCCAGACTGTGGCTGACGGCCTCAAGAAGCAGGAGGAGGAGGA GATGGACTTCCGGTCGGGCTCACCCAGTGACAACTCAGGGGCTGAAGAGATGGAGGTGTCCCTGGCCAAG CCCAAGCACCGCGTGACCATGAACGAGTTTGAGTACCTGAAGCTGCTGGGCAAGGGCACTTTCGGCAAGG TGATCCTGGTGAAGGAGAAGGCCACAGGCCGCTACTACGCCATGAAGATCCTCAAGAAGGAAGTCATCGT GGCCAAGGACGAGGTGGCCCACACACTCACCGAGAACCGCGTCCTGCAGAACTCCAGGCACCCCTTCCTC ACAGCCCTGAAGTACTCTTTCCAGACCCACGACCGCCTCTGCTTTGTCATGGAGTACGCCAACGGGGGCG AGCTGTTCTTCCACCTGTCCCGGGAGCGTGTGTTCTCCGAGGACCGGGCCCGCTTCTATGGCGCTGAGAT TGTGTCAGCCCTGGACTACCTGCACTCGGAGAAGAACGTGGTGTACCGGGACCTCAAGCTGGAGAACCTC ATGCTGGACAAGGACGGGCACATTAAGATCACAGACTTCGGGCTGTGCAAGGAGGGGATCAAGGACGGTG CCACCATGAAGACCTTTTGCGGCACACCTGAGTACCTGGCCCCCGAGGTGCTGGAGGACAATGACTACGG CCGTGCAGTGGACTGGTGGGGGCTGGGCGTGGTCATGTACGAGATGATGTGCGGTCGCCTGCCCTTCTAC AACCAGGACCATGAGAAGCTTTTTGAGCTCATCCTCATGGAGGAGATCCGCTTCCCGCGCACGCTTGGTC CCGAGGCCAAGTCCTTGCTTTCAGGGCTGCTCAAGAAGGACCCCAAGCAGAGGCTTGGCGGGGGCTCCGA GGACGCCAAGGAGATCATGCAGCATCGCTTCTTTGCCGGTATCGTGTGGCAGCACGTGTACGAGAAGAAG CTCAGCCCACCCTTCAAGCCCCAGGTCACGTCGGAGACTGACACCAGGTATTTTGATGAGGAGTTCACGG CCCAGATGATCACCATCACACCACCTGACCAAGATGACAGCATGGAGTGTGTGGACAGCGAGCGCAGGCC CCACTTCCCCCAGTTCTCCTACTCGGCCAGCGGCACGGCCTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001014432 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001014432.1, NP_001014432.1 |
| RefSeq Size | 2878 bp |
| RefSeq ORF | 1443 bp |
| Locus ID | 207 |
| Cytogenetics | 14q32.33 |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Protein Kinase |
| Protein Pathways | Acute myeloid leukemia, Adipocytokine signaling pathway, Apoptosis, B cell receptor signaling pathway, Chemokine signaling pathway, Chronic myeloid leukemia, Colorectal cancer, Endometrial cancer, ErbB signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Focal adhesion, Glioma, Insulin signaling pathway, Jak-STAT signaling pathway, MAPK signaling pathway, Melanoma, mTOR signaling pathway, Neurotrophin signaling pathway, Non-small cell lung cancer, Pancreatic cancer, Pathways in cancer, Progesterone-mediated oocyte maturation, Prostate cancer, Renal cell carcinoma, Small cell lung cancer, T cell receptor signaling pathway, Tight junction, Toll-like receptor signaling pathway, VEGF signaling pathway |
| Gene Summary | 'This gene encodes one of the three members of the human AKT serine-threonine protein kinase family which are often referred to as protein kinase B alpha, beta, and gamma. These highly similar AKT proteins all have an N-terminal pleckstrin homology domain, a serine/threonine-specific kinase domain and a C-terminal regulatory domain. These proteins are phosphorylated by phosphoinositide 3-kinase (PI3K). AKT/PI3K forms a key component of many signalling pathways that involve the binding of membrane-bound ligands such as receptor tyrosine kinases, G-protein coupled receptors, and integrin-linked kinase. These AKT proteins therefore regulate a wide variety of cellular functions including cell proliferation, survival, metabolism, and angiogenesis in both normal and malignant cells. AKT proteins are recruited to the cell membrane by phosphatidylinositol 3,4,5-trisphosphate (PIP3) after phosphorylation of phosphatidylinositol 4,5-bisphosphate (PIP2) by PI3K. Subsequent phosphorylation of both threonine residue 308 and serine residue 473 is required for full activation of the AKT1 protein encoded by this gene. Phosphorylation of additional residues also occurs, for example, in response to insulin growth factor-1 and epidermal growth factor. Protein phosphatases act as negative regulators of AKT proteins by dephosphorylating AKT or PIP3. The PI3K/AKT signalling pathway is crucial for tumor cell survival. Survival factors can suppress apoptosis in a transcription-independent manner by activating AKT1 which then phosphorylates and inactivates components of the apoptotic machinery. AKT proteins also participate in the mammalian target of rapamycin (mTOR) signalling pathway which controls the assembly of the eukaryotic translation initiation factor 4F (eIF4E) complex and this pathway, in addition to responding to extracellular signals from growth factors and cytokines, is disregulated in many cancers. Mutations in this gene are associated with multiple types of cancer and excessive tissue growth including Proteus syndrome and Co' Transcript Variant: This variant (2) lacks the 5' segment, but has an upstream alternate 5' exon, as compared to variant 1. Variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC220361 | AKT1 (Myc-DDK-tagged)-Human v-akt murine thymoma viral oncogene homolog 1 (AKT1), transcript variant 2 |
USD 457.00 |
|
| RG220361 | AKT1 (GFP-tagged) - Human v-akt murine thymoma viral oncogene homolog 1 (AKT1), transcript variant 2 |
USD 460.00 |
|
| RC220361L3 | Lenti ORF clone of Human v-akt murine thymoma viral oncogene homolog 1 (AKT1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
| RC220361L4 | Lenti ORF clone of Human v-akt murine thymoma viral oncogene homolog 1 (AKT1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China