PCOTH (NM_001014442) Human Untagged Clone

CAT#: SC301940

C1QTNF9B (untagged)-Human prostate collagen triple helix (PCOTH), transcript variant 1


  "NM_001014442" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PCOTH"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PCOTH
Synonyms C1QTNF9B-AS1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001014442, the custom clone sequence may differ by one or more nucleotides
ATGTGGATCTTATCAAATTTAATGGGCACATCTGAAGAAGGAAACTTGCTCAGCACCGTG
AGCCCCACAGTGAAAGCACTTTTTGGCAAGACTAGAGTCTCACCGATTTTCCCTTTCTCT
CCTCGATCTCCTTTCCAGCCTCTTATTCCCCGGACTCCTGGCTCACCCTGGGGCCCCGTG
GGTCCAGCTTCTCCCTTGGGACCAGGCTTTCCAATAGGGCCCATGGGGCCCGGTAAACCA
GTTGGGCCCAAAGGCCCAATGTTGCCCCTTGGCCCCTCAGGACCAGTGGGACCCACGTCA
CCCTTATTCCCCTTCTGCCCCTGA
Restriction Sites Please inquire     
ACCN NM_001014442
ORF Size 324 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001014442.2, NP_001014442.2
RefSeq Size 825
RefSeq ORF 324
Locus ID 542767
Gene Summary May be involved in growth and survival of prostate cancer cells through the TAF-Ibeta pathway. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes a 107 amino acid protein (isoform 1). Expression of this transcript and protein is described by Anazawa et al. (see PubMed ID 15930275).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.