mu Crystallin (CRYM) (NM_001014444) Human Untagged Clone

CAT#: SC301942

CRYM (untagged)-Human crystallin, mu (CRYM), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CRYM
• Synonyms: DFNA40; THBP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001014444, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCAGCCCGTGCGCACCGTGGTGCCGGTGACCAAGCACAGGGGCTACCTGGGGGTCATGCCCGCCTACA
  GTGCTGCAGAGGATGCACTGACCACCAAGTTGGTCACCTTCTACGAGGACCGCGGCATCACCTCGGTCGT
  CCCTTCCCACCAGGCTACTGTGCTACTCTTTGAGCCCAGCAATGGCACCCTGCTGGCGGTCATGGATGGA
  AATGTCATAACTGCAAAGAGAACAGCTGCAGTTTCTGCCATTGCCACCAAGTTTCTGAAACCTCCCAGCA
  GTGAAGTGCTGTGCATCCTTGGGGCTGGGGTCCAGGCCTACAGCCATTATGAGATCTTCACAGAGCAGTT
  CTCCTTTAAGGAGGTGAGGATATGGAACCGCACCAAAGAAAATGCAGAGAAGTTTGCAGACACAGTGCAA
  GGAGAGGTACGGGTCTGTTCTTCGGTCCAGGAGGCTGTGGCAGGTGCAGATGTGATCATCACAGTCACCC
  TGGCAACAGAGCCCATTTTGTTTGGTGAATGGGTGAAGCCAGGGGCTCACATCAATGCTGTTGGAGCCAG
  CAGACCTGACTGGAGAGAACTGGATGATGAGCTCATGAAAGAAGCTGTGCTGTACGTGGATTCCCAGGAG
  GCTGCCCTGAAGGAGTCTGGAGATGTCCTGCTGTCAGGGGCCGAGATCTTTGCTGAGCTGGGAGAAGTGA
  TTAAGGGAGTGAAACCAGCCCACTGTGAGAAGACCACCGTGTTCAAGTCTTTGGGAATGGCAGTGGAAGA
  CACAGTTGCAGCCAAACTCATCTATGATTCCTGGTCATCTGGTAAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001014444
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001014444.2, NP_001014444.1
• RefSeq Size: 1232 bp
• RefSeq ORF: 819 bp
• Locus ID: 1428
• Cytogenetics: 16p12.2
• Gene Summary: 'Crystallins are separated into two classes: taxon-specific and ubiquitous. The former class is also called phylogenetically-restricted crystallins. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. This gene encodes a taxon-specific crystallin protein that binds NADPH and has sequence similarity to bacterial ornithine cyclodeaminases. The encoded protein does not perform a structural role in lens tissue, and instead it binds thyroid hormone for possible regulatory or developmental roles. Mutations in this gene have been associated with autosomal dominant non-syndromic deafness. [provided by RefSeq, Sep 2014]'
  Transcript Variant: This variant (2) differs in the 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1.