PAK4 (NM_001014835) Human Untagged Clone

CAT#: SC301963

PAK4 (untagged)-Human p21 protein (Cdc42/Rac)-activated kinase 4 (PAK4), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PAK4
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001014835, the custom clone sequence may differ by one or more nucleotides
  ATGTTTGGGAAGAGGAAGAAGCGGGTGGAGATCTCCGCGCCGTCCAACTTCGAGCACCGC
  GTGCACACGGGCTTCGACCAGCACGAGCAGAAGTTCACGGGGCTGCCCCGCCAGTGGCAG
  AGCCTGATCGAGGAGTCGGCTCGCCGGCCCAAGCCCCTCGTCGACCCCGCCTGCATCACC
  TCCATCCAGCCCGGGGCCCCCAAGGGGGAGCCTCATGACGTGGCCCCTAACGGGCCATCA
  GCGGGGGGCCTGGCCATCCCCCAGTCCTCCTCCTCCTCCTCCCGGCCTCCCACCCGAGCC
  CGAGGTGCCCCCAGCCCTGGAGTGCTGGGACCCCACGCCTCAGAGCCCCAGCTGGCCCCT
  CCAGCCTGCACCCCCGCCGCCCCTGCTGTTCCTGGGCCCCCTGGCCCCCGCTCACCACAG
  CGGGAGCCACAGCGAGTATCCCATGAGCAGTTCCGGGCTGCCCTGCAGCTGGTGGTGGAC
  CCAGGCGACCCCCGCTCCTACCTGGACAACTTCATCAAGATTGGCGAGGGCTCCACGGGC
  ATCGTGTGCATCGCCACCGTGCGCAGCTCGGGCAAGCTGGTGGCCGTCAAGAAGATGGAC
  CTGCGCAAGCAGCAGAGGCGCGAGCTGCTCTTCAACGAGGTGGTAATCATGAGGGACTAC
  CAGCACGAGAATGTGGTGGAGATGTACAACAGCTACCTGGTGGGGGACGAGCTCTGGGTG
  GTCATGGAGTTCCTGGAAGGAGGCGCCCTCACCGACATCGTCACCCACACCAGGATGAAC
  GAGGAGCAGATCGCGGCCGTGTGCCTTGCAGTGCTGCAGGCCCTGTCGGTGCTCCACGCC
  CAGGGCGTCATCCACCGGGACATCAAGAGCGACTCGATCCTGCTGACCCATGATGGCAGG
  GTGAAGCTGTCAGACTTTGGGTTCTGCGCCCAGGTGAGCAAGGAAGTGCCCCGAAGGAAG
  TCGCTGGTCGGCACGCCCTACTGGATGGCCCCAGAGCTCATCTCCCGCCTTCCCTACGGG
  CCAGAGGTAGACATCTGGTCGCTGGGGATAATGGTGATTGAGATGGTGGACGGAGAGCCC
  CCCTACTTCAACGAGCCACCCCTCAAAGCCATGAAGATGATTCGGGACAACCTGCCACCC
  CGACTGAAGAACCTGCACAAGGTGTCGCCATCCCTGAAGGGCTTCCTGGACCGCCTGCTG
  GTGCGAGACCCTGCCCAGCGGGCCACGGCAGCCGAGCTGCTGAAGCACCCATTCCTGGCC
  AAGGCAGGGCCGCCTGCCAGCATCGTGCCCCTCATGCGCCAGAACCGCACCAGATGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001014835
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001014835.1, NP_001014835.1
• RefSeq Size: 2379 bp
• RefSeq ORF: 1317 bp
• Locus ID: 10298
• Cytogenetics: 19q13.2
• Protein Families: Druggable Genome, Protein Kinase
• Protein Pathways: Axon guidance, ErbB signaling pathway, Focal adhesion, Regulation of actin cytoskeleton, Renal cell carcinoma, T cell receptor signaling pathway
• Gene Summary: PAK proteins, a family of serine/threonine p21-activating kinases, include PAK1, PAK2, PAK3 and PAK4. PAK proteins are critical effectors that link Rho GTPases to cytoskeleton reorganization and nuclear signaling. They serve as targets for the small GTP binding proteins Cdc42 and Rac and have been implicated in a wide range of biological activities. PAK4 interacts specifically with the GTP-bound form of Cdc42Hs and weakly activates the JNK family of MAP kinases. PAK4 is a mediator of filopodia formation and may play a role in the reorganization of the actin cytoskeleton. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (4) lacks an in-frame exon in the coding region, as compared to variant 1. The encoded isoform (2) thus lacks an internal segment, as compared to isoform 1.