LAT (NM_001014988) Human Untagged Clone

CAT#: SC301978

LAT (untagged)-Human linker for activation of T cells (LAT), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LAT
• Synonyms: IMD52; LAT1; pp36
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001014988, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGGAGGCCATCCTGGTCCCCTGCGTGCTGGGGCTCCTGCTGCTGCCCATCCTGGCCATGTTGATGG
  CACTGTGTGTGCACTGCCACAGACTGCCAGGCTCCTACGACAGCACATCCTCAGATAGTTTGTATCCAAG
  GGGCATCCAGTTCAAACGGCCTCACACGGTTGCCCCCTGGCCACCTGCCTACCCACCTGTCACCTCCTAC
  CCACCCCTGAGCCAGCCAGACCTGCTCCCCATCCCATCCCCGCAGCCCCTTGGGGGCTCCCACCGGACGC
  CATCTTCCCGGCGGGATTCTGATGGTGCCAACAGTGTGGCGAGCTACGAGAACGAGGAACCAGCCTGTGA
  GGATGCGGATGAGGATGAGGACGACTATCACAACCCAGGCTACCTGGTGGTGCTTCCTGACAGCACCCCG
  GCCACTAGCACTGCTGCCCCATCAGCTCCTGCACTCAGCACCCCTGGCATCCGAGACAGTGCCTTCTCCA
  TGGAGTCCATTGATGATTACGTGAACGTTCCGGAGAGCGGGGAGAGCGCAGAAGCGTCTCTGGATGGCAG
  CCGGGAGTATGTGAATGTGTCCCAGGAACTGCATCCTGGAGCGGCTAAGACTGAGCCTGCCGCCCTGAGT
  TCCCAGGAGGCAGAGGAAGTGGAGGAAGAGGGGGCTCCAGATTACGAGAATCTGCAGGAGCTGAACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001014988
• ORF Size: 699 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001014988.1, NP_001014988.1
• RefSeq Size: 1677
• RefSeq ORF: 699
• Locus ID: 27040
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Natural killer cell mediated cytotoxicity, T cell receptor signaling pathway
• Gene Summary: The protein encoded by this gene is phosphorylated by ZAP-70/Syk protein tyrosine kinases following activation of the T-cell antigen receptor (TCR) signal transduction pathway. This transmembrane protein localizes to lipid rafts and acts as a docking site for SH2 domain-containing proteins. Upon phosphorylation, this protein recruits multiple adaptor proteins and downstream signaling molecules into multimolecular signaling complexes located near the site of TCR engagement. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence and uses an alternate in-frame splice junction at the 5' end of an exon compared to variant 4. The resulting isoform (c) is shorter at the N- terminus and lacks an internal aa compared to isoform d.