CKMT1A (NM_001015001) Human Untagged Clone

CAT#: SC301983

CKMT1A (untagged)-Human creatine kinase, mitochondrial 1A (CKMT1A), nuclear gene encoding mitochondrial protein


  "NM_001015001" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CKMT1A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CKMT1A
Synonyms CKMT1; mia-CK; U-MtCK
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001015001, the custom clone sequence may differ by one or more nucleotides


ATGGCTGGTCCCTTCTCCCGTCTGCTGTCCGCCCGCCCGGGACTCAGGCTCCTGGCTTTGGCCGGAGCGG
GGTCTCTAGCCGCTGGGTTTCTGCTCCGACCGGAACCTGTACGAGCTGCCAGTGAACGACGGAGGCTGTA
TCCCCCGAGCGCTGAGTACCCAGACCTCCGAAAGCACAACAACTGCATGGCCAGTCACCTGACCCCAGCA
GTCTATGCACGGCTCTGCGACAAGACCACACCCACTGGTTGGACGCTAGATCAGTGTATCCAGACTGGCG
TGGACAACCCTGGCCACCCCTTCATCAAGACTGTGGGCATGGTGGCTGGAGATGAGGAGACCTATGAGGT
ATTTGCTGACCTGTTTGACCCTGTGATCCAAGAGCGACACAATGGATATGACCCCCGGACAATGAAGCAC
ACCACGGATCTAGATGCCAGTAAAATCCGTTCTGGCTACTTTGATGAGAGGTATGTATTGTCCTCTAGAG
TCAGAACTGGCCGAAGCATCCGAGGACTCAGTCTGCCTCCAGCTTGCACTCGAGCAGAGCGACGAGAGGT
GGAACGTGTTGTGGTGGATGCACTGAGTGGCCTGAAGGGTGACCTGGCTGGACGTTACTATAGGCTCAGT
GAGATGACAGAGGCTGAACAGCAGCAGCTTATTGATGACCACTTTCTGTTTGATAAGCCTGTGTCCCCGT
TGCTGACTGCAGCAGGAATGGCTCGAGACTGGCCAGATGCTCGTGGAATTTGGCACAACAATGAGAAGAG
CTTCCTGATCTGGGTGAATGAGGAGGATCATACACGGGTGATCTCCATGGAGAAGGGTGGTAACATGAAG
AGAGTGTTTGAAAGATTCTGCCGAGGCCTCAAAGAGGTGGAGAGACTTATCCAAGAACGTGGCTGGGAGT
TCATGTGGAATGAGCGTTTGGGATACATCTTGACCTGTCCATCTAACCTGGGCACTGGACTTCGGGCAGG
AGTGCACATCAAACTGCCCCTGCTAAGCAAAGATAGCCGCTTCCCAAAGATCCTGGAGAACCTAAGACTC
CAAAAGCGTGGTACTGGAGGAGTGGACACTGCTGCCACAGGCGGTGTCTTTGATATTTCTAATTTGGACC
GACTAGGCAAATCAGAGGTGGAGCTGGTGCAACTGGTCATCGATGGAGTAAACTATTTGATTGATTGTGA
ACGGCGTCTGGAGAGAGGCCAGGATATCCGCATCCCCACACCTGTCATCCACACCAAGCATTAA


Restriction Sites SgfI-MluI     
ACCN NM_001015001
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001015001.2, NP_001015001.1
RefSeq Size 1879 bp
RefSeq ORF 1254 bp
Locus ID 548596
Cytogenetics 15q15.3
Protein Families Druggable Genome
Protein Pathways Arginine and proline metabolism, Metabolic pathways
Gene Summary Mitochondrial creatine (MtCK) kinase is responsible for the transfer of high energy phosphate from mitochondria to the cytosolic carrier, creatine. It belongs to the creatine kinase isoenzyme family. It exists as two isoenzymes, sarcomeric MtCK and ubiquitous MtCK, encoded by separate genes. Mitochondrial creatine kinase occurs in two different oligomeric forms: dimers and octamers, in contrast to the exclusively dimeric cytosolic creatine kinase isoenzymes. Many malignant cancers with poor prognosis have shown overexpression of ubiquitous mitochondrial creatine kinase; this may be related to high energy turnover and failure to eliminate cancer cells via apoptosis. Ubiquitous mitochondrial creatine kinase has 80% homology with the coding exons of sarcomeric mitochondrial creatine kinase. Two genes located near each other on chromosome 15 have been identified which encode identical mitochondrial creatine kinase proteins. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.