BAG5 (NM_001015048) Human Untagged Clone

CAT#: SC301988

BAG5 (untagged)-Human BCL2-associated athanogene 5 (BAG5), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BAG5
• Synonyms: BAG-5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001015048, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGATATGGGAAACCAACATCCTTCTATTAGTAGGCTTCAGGAAATCCAAAAGGAAGTAAAAAGTGTAG
  AACAGCAAGTTATCGGCTTCAGTGGTCTGTCAGATGACAAGAATTACAAGAAACTGGAGAGGATTCTAAC
  AAAACAGCTTTTTGAAATAGACTCTGTAGATACTGAAGGAAAAGGAGATATTCAGCAAGCTAGGAAGCGG
  GCAGCACAGGAGACAGAACGTCTTCTCAAAGAGTTGGAGCAGAATGCAAACCACCCACACCGGATTGAAA
  TACAGAACATTTTTGAGGAAGCCCAGTCCCTCGTGAGAGAGAAAATTGTGCCATTTTATAATGGAGGCAA
  CTGCGTAACTGATGAGTTTGAAGAAGGCATCCAAGATATCATTCTGAGGCTGACACATGTTAAAACTGGA
  GGAAAAATCTCCTTGCGGAAAGCAAGGTATCACACTTTAACCAAAATCTGTGCGGTGCAAGAGATAATCG
  AAGACTGCATGAAAAAGCAGCCTTCCCTGCCGCTTTCCGAGGATGCACATCCTTCCGTTGCCAAAATCAA
  CTTCGTGATGTGTGAGGTGAACAAGGCCCGAGGGGTCCTGATTGCACTTCTGATGGGTGTGAACAACAAT
  GAGACCTGCAGGCACTTATCCTGTGTGCTCTCGGGGCTGATCGCTGACCTGGATGCTCTAGATGTGTGCG
  GCCGGACAGAAATCAGAAATTATCGGAGGGAGGTAGTAGAAGATATCAACAAATTATTGAAATATCTGGA
  TTTGGAAGAGGAAGCAGACACAACTAAAGCATTTGACCTGAGACAGAATCATTCCATTTTAAAAATAGAA
  AAGGTCCTCAAGAGAATGAGAGAAATAAAAAATGAACTTCTCCAAGCACAAAACCCTTCTGAATTGTACC
  TGAGCTCCAAAACAGAATTGCAGGGTTTAATTGGACAGTTGGATGAGGTAAGTCTTGAAAAAAACCCCTG
  CATCCGGGAAGCCAGGAGAAGAGCAGTGATCGAGGTGCAAACTCTGATCACATATATTGACTTGAAGGAG
  GCCCTTGAGAAAAGAAAGCTGTTTGCTTGTGAGGAGCACCCATCCCATAAAGCCGTCTGGAACGTCCTTG
  GAAACTTGTCTGAGATCCAGGGAGAAGTTCTTTCATTTGATGGAAATCGAACCGATAAGAACTACATCCG
  GCTGGAAGAGCTGCTCACCAAGCAGCTGCTAGCCCTGGATGCTGTTGATCCGCAGGGAGAAGAGAAGTGT
  AAGGCTGCCAGGAAACAAGCTGTGAGGCTTGCGCAGAATATTCTCAGCTATCTCGACCTGAAATCTGATG
  AATGGGAGTACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001015048
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001015048.2, NP_001015048.1
• RefSeq Size: 4866 bp
• RefSeq ORF: 1344 bp
• Locus ID: 9529
• Cytogenetics: 14q32.33
• Protein Families: Druggable Genome
• Gene Summary: The protein encoded by this gene is a member of the BAG1-related protein family. BAG1 is an anti-apoptotic protein that functions through interactions with a variety of cell apoptosis and growth related proteins including BCL-2, Raf-protein kinase, steroid hormone receptors, growth factor receptors and members of the heat shock protein 70 kDa family. This protein contains a BAG domain near the C-terminus, which could bind and inhibit the chaperone activity of Hsc70/Hsp70. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) differs in the 5' UTR and coding region compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2 and 3 both encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.