PHD finger protein 6 (PHF6) (NM_001015877) Human Untagged Clone

CAT#: SC302002

PHF6 (untagged)-Human PHD finger protein 6 (PHF6), transcript variant 1


  "NM_001015877" in other vectors (4)

Reconstitution Protocol

USD 630.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PHF6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PHF6
Synonyms BFLS; BORJ; CENP-31
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001015877, the custom clone sequence may differ by one or more nucleotides


ATGTCAAGCTCAGTTGAACAGAAAAAAGGGCCTACAAGACAGCGCAAATGTGGCTTTTGTAAGTCAAATA
GAGACAAGGAATGTGGACAGTTACTAATATCTGAAAACCAGAAGGTGGCAGCGCACCATAAGTGCATGCT
CTTTTCATCTGCTTTGGTATCATCACACTCTGATAATGAAAGTCTTGGTGGATTTTCTATTGAAGATGTC
CAAAAGGAAATTAAAAGAGGCACGAAGCTGATGTGTTCTTTGTGCCATTGTCCTGGAGCAACAATTGGTT
GTGATGTGAAAACATGTCACAGGACATACCACTACCACTGTGCATTGCATGATAAAGCTCAAATACGAGA
GAAACCTTCACAAGGAATTTACATGGTCTATTGCCGAAAACACAAGAAAACTGCACATAACTCCGAAGCT
GATTTAGAAGAAAGTTTTAATGAACATGAACTGGAGCCCTCATCACCTAAAAGTAAAAAGAAAAGTCGCA
AAGGAAGGCCAAGAAAAACTAATTTTAAAGGGCTGTCAGAAGATACCAGGTCCACATCCTCCCATGGAAC
AGATGAAATGGAAAGTAGTTCCTATAGAGATAGGTCTCCACACAGAAGCAGCCCTAGTGACACCAGGCCT
AAATGTGGATTTTGCCATGTAGGGGAGGAAGAAAATGAAGCACGAGGAAAACTGCATATATTTAATGCCA
AGAAGGCAGCTGCCCATTATAAGTGCATGTTGTTTTCTTCTGGCACAGTCCAGCTCACAACAACATCAAG
AGCAGAATTTGGAGACTTTGATATTAAAACTGTACTTCAGGAGATTAAACGAGGAAAAAGAATGAAATGT
ACACTTTGCAGTCAGCCTGGTGCTACTATTGGATGTGAAATAAAAGCCTGTGTTAAGACTTACCATTACC
ACTGTGGAGTACAAGACAAAGCTAAATACATTGAAAATATGTCACGAGGAATTTACAAACTATACTGTAA
AAATCATAGTGGAAATGATGAGAGAGATGAAGAAGATGAGGAACGAGAGAGTAAAAGCCGAGGAAAAGTA
GAAATTGATCAGCAACAACTAACTCAGCAGCAACTTAATGGAAACTAG


Restriction Sites SgfI-MluI     
ACCN NM_001015877
ORF Size 1098 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001015877.1, NP_001015877.1
RefSeq Size 4442
RefSeq ORF 1098
Locus ID 84295
Protein Families Druggable Genome, Transcription Factors
Gene Summary This gene is a member of the plant homeodomain (PHD)-like finger (PHF) family. It encodes a protein with two PHD-type zinc finger domains, indicating a potential role in transcriptional regulation, that localizes to the nucleolus. Mutations affecting the coding region of this gene or the splicing of the transcript have been associated with Borjeson-Forssman-Lehmann syndrome (BFLS), a disorder characterized by cognitive disability, epilepsy, hypogonadism, hypometabolism, obesity, swelling of subcutaneous tissue of the face, narrow palpebral fissures, and large ears. Alternate splicing results in multiple transcript variants, encoding different isoforms. [provided by RefSeq, Jun 2010]
Transcript Variant: This variant (1, also called the 'PHF6a' variant) represents the shortest transcript and encodes the shortest isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.