NHLRC3 (NM_001017370) Human Untagged Clone
CAT#: SC302023
NHLRC3 (untagged)-Human NHL repeat containing 3 (NHLRC3), transcript variant 2
"NM_001017370" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NHLRC3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001017370, the custom clone sequence may differ by one or more nucleotides
ATGGCGAGATTCTGGGTCTGCGTAGCCGGTGCTGGCTTCTTTCTTGCATTTTTGGTTTTGCATTCGCGTT TTTGTGGCTCTCCAGTTTTGAGGAACTTTACTTTTGCAGTTTCCTGGAGAACTGAGAAAATTCTTTACCG GCTGGATGTGGGTTGGCCTAAGCACCCAGAATATTTTACCGGAACAACATTTTGTGTTGCAGTTGACTCC CTCAATGGATTGGTTTACATAGGTCAAAGAGGGGATAACATCCCAAAGATATTAGTGTTCACAGAGGATG GATATTTCCTACGAGCCTGGAATTATACAGTTGACACACCTCATGGTATATTTGCAGCCAGTACTCTATA TGAACAATCCGTCTGGATCACGGATGTAGGAAGTGATTTCATGATCCTTTGGCTGCATGGAGAAAATGGG ACAGGGCCTGCTAAGTTCAACATACCTCACAGTGTTACACTTGATTCAGCTGGTCGGGTGTGGGTTGCTG ACCGAGGAAATAAAAGAATCCAAGTATTTGATAAAGACACTGGGGAGTGGTTAGGAGCATGGAATAATTG TTTCACAGAAGAGGGACCTTCTTCAGTCAGGTTTACTCCTGATGGGAAGTACTTGATTGTGGCCCAGCTG AATCTTAGCAGGCTCTCAGTCGTAGCAGCACCCCCAGTGGGAAGCATTGGGGAGTGTTCTGTGATCAGCA CAATCCAACTAGCAGATCAAGTTTTGCCACATCTCCTAGAAGTCGACAGAAAGACTGGAGCAGTCTATGT AGCAGAAATTGGAGCAAAACAAGTACAAAAATATGTCCCTTTGAATAGCTATGTTCCTTCATTTGGTTCA TAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001017370 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001017370.2, NP_001017370.1 |
RefSeq Size | 3368 bp |
RefSeq ORF | 843 bp |
Locus ID | 387921 |
Cytogenetics | 13q13.3 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a protein containing NCL-1, HT2A and Lin-41 (NHL) family repeats. Mammalian NHL-repeat containing proteins may be involved in a variety of enzymatic processes, including protein modification through ubiquitination. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Aug 2012] Transcript Variant: This variant (2) lacks an alternate exon in the coding region, compared to variant 1. The encoded isoform (b) is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214742 | NHLRC3 (Myc-DDK-tagged)-Human NHL repeat containing 3 (NHLRC3), transcript variant 2 |
USD 420.00 |
|
RG214742 | NHLRC3 (GFP-tagged) - Human NHL repeat containing 3 (NHLRC3), transcript variant 2 |
USD 460.00 |
|
RC214742L3 | Lenti ORF clone of Human NHL repeat containing 3 (NHLRC3), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC214742L4 | Lenti ORF clone of Human NHL repeat containing 3 (NHLRC3), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review