ZNF2 (NM_001017396) Human Untagged Clone

CAT#: SC302034

ZNF2 (untagged)-Human zinc finger protein 2 (ZNF2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ZNF2
• Synonyms: A1-5; Zfp661; ZNF661
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001017396, the custom clone sequence may differ by one or more nucleotides
  ATGCTGGAGAACTATAACAGCATTGTGTCATTGGGCCTTCCAGTTCCTCAACCTGATGTG
  ATTTTCCAATTGAAGAGAGGGGACAAGCCGTGGATGGTAGATCTTCATGGGTCTGAGGAG
  AGAGAATGGCCAGAGAGTGTCTCTCTAGACTGGGAAACTAAGCCTGAGATTCACGATGCT
  TCAGACAAAAAATCAGAAGGATCATTGAGGGAATGCCTTGGAAGGCAAAGTCCTCTGTGT
  CCTAAATTTGAAGTTCATACACCCAATGGCAGGATGGGAACAGAAAAGCAAAGCCCTTCA
  GGGGAGACTCGTAAGAAATCCCTCTCCCGGGACAAAGGCTTGCGGCGACGGTCAGCCCTG
  TCCAGGGAAATTCTCACTAAAGAGAGACACCAGGAATGCAGTGACTGTGGGAAGACCTTT
  TTTGACCACTCATCCCTCACCCGCCATCAGAGGACTCACACTGGGGAGAAGCCCTACGAC
  TGCCGCGAGTGTGGGAAAGCCTTCAGCCACAGGAGCAGCCTCAGCAGACATCTGATGTCA
  CACACTGGGGAGAGCCCCTACGAGTGCAGTGTGTGCTCAAAAGCCTTCTTTGACCGTTCG
  TCCCTAACTGTCCATCAGCGAATTCACACTGGAGAGAAACCCTTTCAGTGCAACGAGTGT
  GGAAAAGCCTTTTTTGACCGTTCATCCCTTACTCGACACCAGAGAATTCACACTGGAGAA
  AGTCCTTATGAATGTCATCAGTGTGGGAAAGCCTTTAGCCAGAAAAGTATTCTTACTCGC
  CATCAGCTAATCCACACTGGCAGGAAGCCTTATGAGTGTAACGAGTGCGGGAAAGCTTTC
  TATGGTGTCTCGTCTCTGAATAGACATCAGAAAGCTCATGCTGGGGACCCTCGCTATCAG
  TGTAACGAGTGTGGCAAAGCTTTCTTTGACCGCTCATCCCTTACACAGCATCAGAAGATC
  CACACTGGAGACAAGCCATATGAATGCAGCGAATGCGGGAAAGCCTTTAGCCAGCGGTGC
  CGGCTCACGCGGCATCAGCGTGTCCACACGGGAGAGAAGCCCTTTGAATGCACTGTGTGT
  GGGAAAGTTTTCAGTTCAAAATCTTCTGTTATTCAACATCAACGGCGTTACGCCAAACAG
  GGAATAGACTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001017396
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001017396.1, NP_001017396.1
• RefSeq Size: 3879 bp
• RefSeq ORF: 1152 bp
• Locus ID: 7549
• Cytogenetics: 2q11.1
• Protein Families: Transcription Factors
• Gene Summary: 'The protein encoded by this gene belongs to the C2H2-type zinc-finger protein family. The exact function of this gene is not known, however, zinc-finger proteins are known to interact with DNA and function as transcription regulators. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]'
  Transcript Variant: This variant (2) lacks an alternate exon in the 5' region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (b) has a shorter N-terminus than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.