RNF98 (TRIM36) (NM_001017397) Human Untagged Clone

CAT#: SC302035

TRIM36 (untagged)-Human tripartite motif containing 36 (TRIM36), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TRIM36
• Synonyms: ANPH; HAPRIN; RBCC728; RNF98
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001017397, the custom clone sequence may differ by one or more nucleotides
  ATGTCGGAGTCTGGGGAGATGAGTGAATTTGGCTACATCATGGAATTGATAGCTAAAGGC
  AAGATGCCGGATTGGAGACGAGGCTACCGCTGCAGACAGGGCTGTGGGAAGACGACGGAA
  CTTGCCACAGCGACAGACTTCTCCCAAACAGGAAATAAAAGTGGGAAGCATTTTAAAACC
  TAA
  
• Restriction Sites: Please inquire
• ACCN: NM_001017397
• ORF Size: 183 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001017397.1, NP_001017397.1
• RefSeq Size: 760
• RefSeq ORF: 183
• Locus ID: 55521
• Protein Families: Druggable Genome
• Gene Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) lacks several 3' exons, but has a much shorter and alternate 3' segment, as compared to variant 1. The resulting isoform (2) has a much shorter and distinct C-terminus, as compared to isoform 1.