ARHGAP8 (NM_001017526) Human Untagged Clone

CAT#: SC302062

ARHGAP8 (untagged)-Human Rho GTPase activating protein 8 (ARHGAP8), transcript variant 1


  "NM_001017526" in other vectors (4)

Reconstitution Protocol

USD 780.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ARHGAP8"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ARHGAP8
Synonyms BPGAP1; PP610
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001017526, the custom clone sequence may differ by one or more nucleotides


ATGGCTGGCCAGGATCCTGCGCTGAGCACGAGTCACCCGTTCTACGACGTGGCCAGACATGGCATTCTGC
AGGTGGCAGGGGATGACCGCTTTGGAAGACGTGTTGTCACGTTCAGCTGCTGCCGGATGCCACCCTCCCA
CGAGCTGGACCACCAGCGGCTGCTGGAGTATTTGAAGTACACACTGGACCAATACGTTGAGAACGATTAT
ACCATCGTCTATTTCCACTACGGGCTGAACAGCCGGAACAAGCCTTCCCTGGGCTGGCTCCAGAGCGCAT
ACAAGGAGTTCGATAGGAAAGACGGGGATCTCACTATGTGGCCCAGGCTGGTCTCGAACTCCAAGCTCAA
GCGATCCTCCCACCTCAGCCTCCCAAAGTACTGGGATTACAGGTACAAGAAGAACTTGAAGGCCCTCTAC
GTGGTGCACCCCACCAGCTTCATCAAGGTCCTGTGGAACATCTTGAAGCCCCTCATCAGTCACAAGTTTG
GGAAGAAAGTCATCTATTTCAACTACCTGAGTGAGCTCCACGAACACCTTAAATACGACCAGCTGGTCAT
CCCTCCCGAAGTTTTGCGGTACGATGAGAAGCTCCAGAGCCTGCACGAGGGCCGGACGCCGCCTCCCACC
AAGACACCACCGCCGCGGCCCCCGCTGCCCACACAGCAGTTTGGCGTCAGTCTGCAATACCTCAAAGACA
AAAATCAAGGCGAACTCATCCCCCCTGTGCTGAGGTTCACAGTGACGTACCTGAGAGAGAAAGGCCTGCG
CACCGAGGGCCTGTTCCGGAGATCCGCCAGCGTGCAGACCGTCCGCGAGATCCAGAGGCTCTACAACCAA
GGGAAGCCCGTGAACTTTGACGACTACGGGGACATTCACATCCCTGCCGTGATCCTGAAGACCTTCCTGC
GAGAGCTGCCCCAGCCGCTTCTGACCTTCCAGGCCTACGAGCAGATTCTCGGGATCACCTGTGTGGAGAG
CAGCCTGCGTGTCACTGGCTGCCGCCAGATCTTACGGAGCCTCCCAGAGCACAACTACGTCGTCCTCCGC
TACCTCATGGGCTTCCTGCATGCGGTGTCCCGGGAGAGCATCTTCAACAAAATGAACAGCTCTAACCTGG
CCTGTGTCTTCGGGCTGAATTTGATCTGGCCATCCCAGGGGGTCTCCTCCCTGAGTGCCCTTGTGCCCCT
GAACATGTTCACTGAACTGCTGATCGAGTACTATGAAAAGATCTTCAGCACCCCGGAGGCACCTGGGGAG
CACGGCCTGGCACCATGGGAACAGGGGAGCAGGGCAGCCCCTTTGCAGGAGGCTGTGCCACGGACACAAG
CCACGGGCCTCACCAAGCCTACCCTACCTCCGAGTCCCCTGATGGCAGCCAGAAGACGTCTCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001017526
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001017526.1, NP_001017526.1
RefSeq Size 1725 bp
RefSeq ORF 1395 bp
Locus ID 23779
Cytogenetics 22q13.31
Gene Summary This gene encodes a member of the RHOGAP family. GAP (GTPase-activating) family proteins participate in signaling pathways that regulate cell processes involved in cytoskeletal changes. GAP proteins alternate between an active (GTP-bound) and inactive (GDP-bound) state based on the GTP:GDP ratio in the cell. This family member is a multidomain protein that functions to promote Erk activation and cell motility. Alternative splicing results in multiple transcript variants. Read-through transcripts from the upstream proline rich 5, renal (PRR5) gene into this gene also exist, which led to the original description of PRR5 and ARHGAP8 being a single gene. [provided by RefSeq, Nov 2010]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.