TPM1 (NM_001018005) Human Untagged Clone
CAT#: SC302119
TPM1 (untagged)-Human tropomyosin 1 (alpha) (TPM1), transcript variant 1
"NM_001018005" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | TPM1 |
| Synonyms | C15orf13; CMD1Y; CMH3; HEL-S-265; HTM-alpha; LVNC9; TMSA |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001018005 edited
GGGAAAGTACATATCTGGGAGAAGCAGGCGGCTCCGCGCTCGCACTCCCGCTCCTCCGCC CGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAGGGCCCCTCGCCGCCGCCACC ATGGACGCCATCAAGAAGAAGATGCAGATGCTGAAGCTCGACAAGGAGAACGCCTTGGAT CGAGCTGAGCAGGCGGAGGCCGACAAGAAGGCGGCGGAAGACAGGAGCAAGCAGCTGGAA GATGAGCTGGTGTCACTGCAAAAGAAACTCAAGGGCACCGAAGATGAACTGGACAAATAC TCTGAGGCTCTCAAAGATGCCCAGGAGAAGCTGGAGCTGGCAGAGAAAAAGGCCACCGAT GCTGAAGCCGACGTAGCTTCTCTGAACAGACGCATCCAGCTGGTTGAGGAAGAGTTGGAT CGTGCCCAGGAGCGTCTGGCAACAGCTTTGCAGAAGCTGGAGGAAGCTGAGAAGGCAGCA GATGAGAGTGAGAGAGGCATGAAAGTCATTGAGAGTCGAGCCCAAAAAGATGAAGAAAAA ATGGAAATTCAGGAGATCCAACTGAAAGAGGCAAAGCACATTGCTGAAGATGCCGACCGC AAATATGAAGAGGTGGCCCGTAAGCTGGTCATCATTGAGAGCGACCTGGAACGTGCAGAG GAGCGGGCTGAGCTCTCAGAAGGCAAATGTGCCGAGCTTGAAGAAGAATTGAAAACTGTG ACGAACAACTTGAAGTCACTGGAGGCTCAGGCTGAGAAGTACTCGCAGAAGGAAGACAGA TATGAGGAAGAGATCAAGGTCCTTTCCGACAAGCTGAAGGAGGCTGAGACTCGGGCTGAG TTTGCGGAGAGGTCAGTAACTAAATTGGAGAAAAGCATTGATGACTTAGAAGACGAGCTG TACGCTCAGAAACTGAAGTACAAAGCCATCAGCGAGGAGCTGGACCACGCTCTCAACGAT ATGACTTCCATATAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001018005 |
| Insert Size | 1000 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001018005.1. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001018005.1, NP_001018005.1 |
| RefSeq Size | 1246 bp |
| RefSeq ORF | 855 bp |
| Locus ID | 7168 |
| Cytogenetics | 15q22.2 |
| Protein Families | Druggable Genome |
| Protein Pathways | Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM) |
| Gene Summary | 'This gene is a member of the tropomyosin family of highly conserved, widely distributed actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. Tropomyosin is composed of two alpha-helical chains arranged as a coiled-coil. It is polymerized end to end along the two grooves of actin filaments and provides stability to the filaments. The encoded protein is one type of alpha helical chain that forms the predominant tropomyosin of striated muscle, where it also functions in association with the troponin complex to regulate the calcium-dependent interaction of actin and myosin during muscle contraction. In smooth muscle and non-muscle cells, alternatively spliced transcript variants encoding a range of isoforms have been described. Mutations in this gene are associated with type 3 familial hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (Tpm1.1, also known as variant 1) represents the shortest transcript. It encodes the longest isoform (Tpm1.1st), also known as the fast skeletal muscle isoform. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218007 | TPM1 (Myc-DDK-tagged)-Human tropomyosin 1 (alpha) (TPM1), transcript variant 1 |
USD 450.00 |
|
| RG218007 | TPM1 (GFP-tagged) - Human tropomyosin 1 (alpha) (TPM1), transcript variant 1 |
USD 460.00 |
|
| RC218007L1 | Lenti-ORF clone of TPM1 (Myc-DDK-tagged)-Human tropomyosin 1 (alpha) (TPM1), transcript variant 1 |
USD 620.00 |
|
| RC218007L2 | Lenti-ORF clone of TPM1 (mGFP-tagged)-Human tropomyosin 1 (alpha) (TPM1), transcript variant 1 |
USD 620.00 |
|
| RC218007L3 | Lenti-ORF clone of TPM1 (Myc-DDK-tagged)-Human tropomyosin 1 (alpha) (TPM1), transcript variant 1 |
USD 620.00 |
|
| RC218007L4 | Lenti-ORF clone of TPM1 (mGFP-tagged)-Human tropomyosin 1 (alpha) (TPM1), transcript variant 1 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China