EMA (MUC1) (NM_001018016) Human Untagged Clone

CAT#: SC302125

MUC1 (untagged)-Human mucin 1, cell surface associated (MUC1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MUC1
• Synonyms: ADMCKD; ADMCKD1; CA 15-3; CD227; EMA; H23AG; KL-6; MAM6; MCD; MCKD; MCKD1; MUC-1; MUC-1/SEC; MUC-1/X; MUC1/ZD; PEM; PEMT; PUM
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001018016 edited
  ATGACACCGGGCACCCAGTCTCCTTTCTTCCTGCTGCTGCTCCTCACAGTGCTTACAGCT
  ACCACAGCCCCTAAACCCGCAACAGTTGTTACGGGTTCTGGTCATGCAAGCTCTACCCCA
  GGTGGAGAAAAGGAGACTTCGGCTACCCAGAGAAGTTCAGTGCCCAGCTCTACTGAGAAG
  AATGCTTTTAATTCCTCTCTGGAAGATCCCAGCACCGACTACTACCAAGAGCTGCAGAGA
  GACATTTCTGAAATGTTTTTGCAGATTTATAAACAAGGGGGTTTTCTGGGCCTCTCCAAT
  ATTAAGTTCAGGCCAGGATCTGTGGTGGTACAATTGACTCTGGCCTTCCGAGAAGGTACC
  ATCAATGTCCACGACGTGGAGACACAGTTCAATCAGTATAAAACGGAAGCAGCCTCTCGA
  TATAACCTGACGATCTCAGACGTCAGCGTGAGTGATGTGCCATTTCCTTTCTCTGCCCAG
  TCTGGGGCTGGGGTGCCAGGCTGGGGCATCGCGCTGCTGGTGCTGGTCTGTGTTCTGGTT
  GCGCTGGCCATTGTCTATCTCATTGCCTTGGCTGTCTGTCAGTGCCGCCGAAAGAACTAC
  GGGCAGCTGGACATCTTTCCAGCCCGGGATACCTACCATCCTATGAGCGAGTACCCCACC
  TACCACACCCATGGGCGCTATGTGCCCCCTAGCAGTACCGATCGTAGCCCCTATGAGAAG
  GTTTCTGCAGGTAATGGTGGCAGCAGCCTCTCTTACACAAACCCAGCAGTGGCAGCCACT
  TCTGCCAACTTGTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001018016
• Insert Size: 800 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001018016.1, NP_001018016.1
• RefSeq Size: 1182 bp
• RefSeq ORF: 795 bp
• Locus ID: 4582
• Cytogenetics: 1q22
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Gene Summary: 'This gene encodes a membrane-bound protein that is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in intracellular signaling. This protein is expressed on the apical surface of epithelial cells that line the mucosal surfaces of many different tissues including lung, breast stomach and pancreas. This protein is proteolytically cleaved into alpha and beta subunits that form a heterodimeric complex. The N-terminal alpha subunit functions in cell-adhesion and the C-terminal beta subunit is involved in cell signaling. Overexpression, aberrant intracellular localization, and changes in glycosylation of this protein have been associated with carcinomas. This gene is known to contain a highly polymorphic variable number tandem repeats (VNTR) domain. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2011]'
  Transcript Variant: This variant (2) uses alternate in-frame splice sites for two exons, compared to variant 1. The resulting isoform (2) is shorter than isoform 1.