EPM2A (NM_001018041) Human Untagged Clone

CAT#: SC302137

EPM2A (untagged)-Human epilepsy, progressive myoclonus type 2A, Lafora disease (laforin) (EPM2A), transcript variant 2


  "NM_001018041" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "EPM2A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EPM2A
Synonyms EPM2; MELF
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001018041, the custom clone sequence may differ by one or more nucleotides
ATGCGCTTCCGCTTTGGGGTGGTGGTGCCACCCGCCGTGGCCGGCGCCCGGCCGGAGCTG
CTGGTGGTGGGGTCGCGGCCCGAGCTGGGGCGTTGGGAGCCGCGCGGTGCCGTCCGCCTG
AGGCCGGCCGGCACCGCGGCGGGCGACGGGGCCCTGGCCCTGCAGGAGCCGGGCCTGTGG
CTCGGGGAGGTGGAGCTGGCGGCCGAGGAGGCGGCGCAGGACGGGGCGGAGCCGGGCCGC
GTGGACACGTTCTGGTACAAGTTCCTGAAGCGGGAGCCGGGAGGAGAGCTCTCCTGGGAA
GGCAATGGACCTCATCATGACCGTTGCTGTACTTACAATGAAAACAACTTGGTGGATGGT
GTGTATTGTCTCCCAATAGGACACTGGATTGAGGCCACTGGGCACACCAATGAAATGAAG
CACACAACAGACTTCTATTTTAATATTGCAGGCCACCAAGCCATGCATTATTCAAGAATT
CTACCAAATATCTGGCTGGGTAGCTGCCCTCGTCAGGTGGAACATGTAACCATCAAACTG
AAGCATGAATTGGGGATTACAGCTGTAATGAATTTCCAGACTGAATGGGATATTGTACAG
AATTCCTCAGGCTGTAACCGCTACCCAGAGCCCATGACTCCAGACACTATGATTAAACTA
TATAGGGAAGAAGGCTTGGCCTACATCTGGATGCCAACACCAGATATGAGCACCGAAGGC
CGAGTACAGATGCTGCCCCAGGCGGTGTGCCTGCTGCATGCGCTGCTGGAGAAGGGACAC
ATCGTGTACGTGCACTGCAACGCTGGGGTGGGCCGCTCCACCGCGGCTGTCTGCGGCTGG
CTCCAGTATGTGATGGGCTGGAATCTGAGGAAGGTGCAGTATTTCCTCATGGCCAAGAGG
CCGGCTGTCTACATTGACGAAGAGGCAGCTAGCCAGGACACATTTCCACTATAA
Restriction Sites Please inquire     
ACCN NM_001018041
ORF Size 954 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001018041.1, NP_001018051.1
RefSeq Size 1711
RefSeq ORF 954
Locus ID 7957
Protein Families Druggable Genome, Phosphatase
Gene Summary This gene encodes a dual-specificity phosphatase and may be involved in the regulation of glycogen metabolism. The protein acts on complex carbohydrates to prevent glycogen hyperphosphorylation, thus avoiding the formation of insoluble aggregates. Loss-of-function mutations in this gene have been associated with Lafora disease, a rare, adult-onset recessive neurodegenerative disease, which results in myoclonus epilepsy and usually results in death several years after the onset of symptoms. The disease is characterized by the accumulation of insoluble particles called Lafora bodies, which are derived from glycogen. [provided by RefSeq, Jan 2018]
Transcript Variant: This variant (2) lacks a segment of the coding region compared to variant 1. The resulting isoform (b), also known as C-terISO, contains a shorter and distinct C-terminus compared to isoform a. Isoform b has been localized to the nucleus.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.