EPM2A (NM_001018041) Human Untagged Clone
CAT#: SC302137
EPM2A (untagged)-Human epilepsy, progressive myoclonus type 2A, Lafora disease (laforin) (EPM2A), transcript variant 2
"NM_001018041" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | EPM2A |
Synonyms | EPM2; MELF |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001018041, the custom clone sequence may differ by one or more nucleotides
ATGCGCTTCCGCTTTGGGGTGGTGGTGCCACCCGCCGTGGCCGGCGCCCGGCCGGAGCTG CTGGTGGTGGGGTCGCGGCCCGAGCTGGGGCGTTGGGAGCCGCGCGGTGCCGTCCGCCTG AGGCCGGCCGGCACCGCGGCGGGCGACGGGGCCCTGGCCCTGCAGGAGCCGGGCCTGTGG CTCGGGGAGGTGGAGCTGGCGGCCGAGGAGGCGGCGCAGGACGGGGCGGAGCCGGGCCGC GTGGACACGTTCTGGTACAAGTTCCTGAAGCGGGAGCCGGGAGGAGAGCTCTCCTGGGAA GGCAATGGACCTCATCATGACCGTTGCTGTACTTACAATGAAAACAACTTGGTGGATGGT GTGTATTGTCTCCCAATAGGACACTGGATTGAGGCCACTGGGCACACCAATGAAATGAAG CACACAACAGACTTCTATTTTAATATTGCAGGCCACCAAGCCATGCATTATTCAAGAATT CTACCAAATATCTGGCTGGGTAGCTGCCCTCGTCAGGTGGAACATGTAACCATCAAACTG AAGCATGAATTGGGGATTACAGCTGTAATGAATTTCCAGACTGAATGGGATATTGTACAG AATTCCTCAGGCTGTAACCGCTACCCAGAGCCCATGACTCCAGACACTATGATTAAACTA TATAGGGAAGAAGGCTTGGCCTACATCTGGATGCCAACACCAGATATGAGCACCGAAGGC CGAGTACAGATGCTGCCCCAGGCGGTGTGCCTGCTGCATGCGCTGCTGGAGAAGGGACAC ATCGTGTACGTGCACTGCAACGCTGGGGTGGGCCGCTCCACCGCGGCTGTCTGCGGCTGG CTCCAGTATGTGATGGGCTGGAATCTGAGGAAGGTGCAGTATTTCCTCATGGCCAAGAGG CCGGCTGTCTACATTGACGAAGAGGCAGCTAGCCAGGACACATTTCCACTATAA |
Restriction Sites | Please inquire |
ACCN | NM_001018041 |
ORF Size | 954 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001018041.1, NP_001018051.1 |
RefSeq Size | 1711 |
RefSeq ORF | 954 |
Locus ID | 7957 |
Protein Families | Druggable Genome, Phosphatase |
Gene Summary | This gene encodes a dual-specificity phosphatase and may be involved in the regulation of glycogen metabolism. The protein acts on complex carbohydrates to prevent glycogen hyperphosphorylation, thus avoiding the formation of insoluble aggregates. Loss-of-function mutations in this gene have been associated with Lafora disease, a rare, adult-onset recessive neurodegenerative disease, which results in myoclonus epilepsy and usually results in death several years after the onset of symptoms. The disease is characterized by the accumulation of insoluble particles called Lafora bodies, which are derived from glycogen. [provided by RefSeq, Jan 2018] Transcript Variant: This variant (2) lacks a segment of the coding region compared to variant 1. The resulting isoform (b), also known as C-terISO, contains a shorter and distinct C-terminus compared to isoform a. Isoform b has been localized to the nucleus. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221554 | EPM2A (Myc-DDK-tagged)-Human epilepsy, progressive myoclonus type 2A, Lafora disease (laforin) (EPM2A), transcript variant 2 |
USD 420.00 |
|
RG221554 | EPM2A (GFP-tagged) - Human epilepsy, progressive myoclonus type 2A, Lafora disease (laforin) (EPM2A), transcript variant 2 |
USD 460.00 |
|
RC221554L3 | Lenti-ORF clone of EPM2A (Myc-DDK-tagged)-Human epilepsy, progressive myoclonus type 2A, Lafora disease (laforin) (EPM2A), transcript variant 2 |
USD 620.00 |
|
RC221554L4 | Lenti-ORF clone of EPM2A (mGFP-tagged)-Human epilepsy, progressive myoclonus type 2A, Lafora disease (laforin) (EPM2A), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review