BRCC36 (BRCC3) (NM_001018055) Human Untagged Clone

CAT#: SC302145

BRCC3 (untagged)-Human BRCA1/BRCA2-containing complex, subunit 3 (BRCC3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BRCC3
• Synonyms: BRCC36; C6.1A; CXorf53
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_001018055 edited
  ATGGCGGTGCAGGTGGTGCAGGCGGTGCAGGCGGTTCATCTCGAGTCTGACGCTTTCCTC
  GTTTGTCTCAACCACGCTCTGAGCACAGAGAAGGAGGAAGTAATGGGGCTGTGCATAGGG
  GAGTTGAACGATGATACAAGGAGTGACTCCAAATTTGCATATACTGGAACTGAAATGCGC
  ACAGTTGCTGAAAAGGTTGATGCCGTCAGAATTGTTCACATTCATTCTGTCATCATCTTA
  CGACGTTCTGATAAGAGGAAGGACCGAGTAGAAATTTCTCCAGAGCAGCTGTCTGCAGCT
  TCAACAGAGGCAGAGAGGTTGGCTGAACTGACAGGCCGCCCCATGAGAGTTGTGGGCTGG
  TATCATTCCCATCCTCATATAACTGTTTGGCCTTCACATGTTGATGTTCGCACACAAGCC
  ATGTACCAGATGATGGATCAAGGCTTTGTAGGACTTATTTTTTCCTGTTTCATAGAAGAT
  AAGAACACAAAGACTGGCCGGGTACTCTACACTTGCTTCCAATCCATACAGGCCCAAAAG
  AGTTCAGAGTATGAGAGAATCGAAATCCCAATCCATATTGTACCTCATGTCACTATCGGG
  AAAGTGTGCCTTGAATCAGCAGTAGAGCTGCCCAAGATCCTGTGCCAGGAGGAGCAGGAT
  GCGTATAGGAGGATCCACAGCCTTACACATCTGGACTCAGTAACCAAGATCCATAATGGC
  TCAGTGTTTACCAAGAATCTGTGCAGTCAGATGTCGGCAGTCAGCGGGCCTCTCCTACAG
  TGGTTGGAGGACAGACTGGAGCAAAACCAACAGCATTTGCAGGAATTACAACAAGAAAAG
  GAAGAGCTTATGCAAGAACTTTCTTCTCTAGAATAA
  
• Restriction Sites: NotI-NotI
• ACCN: NM_001018055
• Insert Size: 2800 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001018055.1.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001018055.1, NP_001018065.1
• RefSeq Size: 2839 bp
• RefSeq ORF: 876 bp
• Locus ID: 79184
• Cytogenetics: Xq28
• Protein Families: Druggable Genome, Protease
• Gene Summary: This gene encodes a subunit of the BRCA1-BRCA2-containing complex (BRCC), which is an E3 ubiquitin ligase. This complex plays a role in the DNA damage response, where it is responsible for the stable accumulation of BRCA1 at DNA break sites. The component encoded by this gene can specifically cleave Lys 63-linked polyubiquitin chains, and it regulates the abundance of these polyubiquitin chains in chromatin. The loss of this gene results in abnormal angiogenesis and is associated with syndromic moyamoya, a cerebrovascular angiopathy. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 5. [provided by RefSeq, Jun 2011]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1.