TrkB (NTRK2) (NM_001018065) Human Untagged Clone
CAT#: SC302153
NTRK2 (untagged)-Human neurotrophic tyrosine kinase, receptor, type 2 (NTRK2), transcript variant d
"NM_001018065" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NTRK2 |
Synonyms | EIEE58; GP145-TrkB; OBHD; trk-B; TRKB |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001018065, the custom clone sequence may differ by one or more nucleotides
ATGTCGTCCTGGATAAGGTGGCATGGACCCGCCATGGCGCGGCTCTGGGGCTTCTGCTGGCTGGTTGTGG GCTTCTGGAGGGCCGCTTTCGCCTGTCCCACGTCCTGCAAATGCAGTGCCTCTCGGATCTGGTGCAGCGA CCCTTCTCCTGGCATCGTGGCATTTCCGAGATTGGAGCCTAACAGTGTAGATCCTGAGAACATCACCGAA ATTTTCATCGCAAACCAGAAAAGGTTAGAAATCATCAACGAAGATGATGTTGAAGCTTATGTGGGACTGA GAAATCTGACAATTGTGGATTCTGGATTAAAATTTGTGGCTCATAAAGCATTTCTGAAAAACAGCAACCT GCAGCACATCAATTTTACCCGAAACAAACTGACGAGTTTGTCTAGGAAACATTTCCGTCACCTTGACTTG TCTGAACTGATCCTGGTGGGCAATCCATTTACATGCTCCTGTGACATTATGTGGATCAAGACTCTCCAAG AGGCTAAATCCAGTCCAGACACTCAGGATTTGTACTGCCTGAATGAAAGCAGCAAGAATATTCCCCTGGC AAACCTGCAGATACCCAATTGTGGTTTGCCATCTGCAAATCTGGCCGCACCTAACCTCACTGTGGAGGAA GGAAAGTCTATCACATTATCCTGTAGTGTGGCAGGTGATCCGGTTCCTAATATGTATTGGGATGTTGGTA ACCTGGTTTCCAAACATATGAATGAAACAAGCCACACACAGGGCTCCTTAAGGATAACTAACATTTCATC CGATGACAGTGGGAAGCAGATCTCTTGTGTGGCGGAAAATCTTGTAGGAGAAGATCAAGATTCTGTCAAC CTCACTGTGCATTTTGCACCAACTATCACATTTCTCGAATCTCCAACCTCAGACCACCACTGGTGCATTC CATTCACTGTGAAAGGCAACCCCAAACCAGCGCTTCAGTGGTTCTATAACGGGGCAATATTGAATGAGTC CAAATACATCTGTACTAAAATACATGTTACCAATCACACGGAGTACCACGGCTGCCTCCAGCTGGATAAT CCCACTCACATGAACAATGGGGACTACACTCTAATAGCCAAGAATGAGTATGGGAAGGATGAGAAACAGA TTTCTGCTCACTTCATGGGCTGGCCTGGAATTGACGATGGTGCAAACCCAAATTATCCTGATGTAATTTA TGAAGATTATGGAACTGCAGCGAATGACATCGGGGACACCACGAACAGAAGTAATGAAATCCCTTCCACA GACGTCACTGATAAAACCGGTCGGGAACATCTCTCGGTCTATGCTGTGGTGGTGATTGCGTCTGTGGTGG GATTTTGCCTTTTGGTAATGCTGTTTCTGCTTAAGTTGGCAAGACACTCCAAGTTTGGCATGAAAGATTT CTCATGGTTTGGATTTGGGAAAGTAAAATCAAGACAAGGTGTTGGCCCAGCCTCCGTTATCAGCAATGAT GATGACTCTGCCAGCCCACTCCATCACATCTCCAATGGGAGTAACACTCCATCTTCTTCGGAAGGTGGCC CAGATGCTGTCATTATTGGAATGACCAAGATCCCTGTCATTGAAAATCCCCAGTACTTTGGCATCACCAA CAGTCAGCTCAAGCCAGACACATGGCCCAGAGGTTCCCCCAAGACCGCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001018065 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001018065.2, NP_001018075.1 |
RefSeq Size | 8340 bp |
RefSeq ORF | 1662 bp |
Locus ID | 4915 |
Cytogenetics | 9q21.33 |
Protein Families | Druggable Genome, Protein Kinase, Transmembrane |
Protein Pathways | MAPK signaling pathway, Neurotrophin signaling pathway |
Gene Summary | 'This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation. Mutations in this gene have been associated with obesity and mood disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]' Transcript Variant: This variant (d) lacks several 3' exons but contains an alternate 3' terminal exon, and it thus differs in the 3' coding region and 3' UTR, compared to variant a. The encoded isoform (d, also known as TrkB-T-Shc) has a distinct C-terminus and is shorter than isoform a. The 5' UTR is incomplete due to a lack of 5'-complete transcript support for this variant, and because there is ambiguity in the 5' UTR splicing pattern. Variants d and m both encode the same isoform (d). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218960 | NTRK2 (Myc-DDK-tagged)-Human neurotrophic tyrosine kinase, receptor, type 2 (NTRK2), transcript variant d |
USD 480.00 |
|
RG218960 | NTRK2 (GFP-tagged) - Human neurotrophic tyrosine kinase, receptor, type 2 (NTRK2), transcript variant d |
USD 530.00 |
|
RC218960L1 | Lenti-ORF clone of NTRK2 (Myc-DDK-tagged)-Human neurotrophic tyrosine kinase, receptor, type 2 (NTRK2), transcript variant d |
USD 680.00 |
|
RC218960L2 | Lenti-ORF clone of NTRK2 (mGFP-tagged)-Human neurotrophic tyrosine kinase, receptor, type 2 (NTRK2), transcript variant d |
USD 680.00 |
|
RC218960L3 | Lenti-ORF clone of NTRK2 (Myc-DDK-tagged)-Human neurotrophic tyrosine kinase, receptor, type 2 (NTRK2), transcript variant d |
USD 680.00 |
|
RC218960L4 | Lenti-ORF clone of NTRK2 (mGFP-tagged)-Human neurotrophic tyrosine kinase, receptor, type 2 (NTRK2), transcript variant d |
USD 680.00 |
{0} Product Review(s)
Be the first one to submit a review