KIR2DL5B (NM_001018081) Human Untagged Clone

CAT#: SC302167

KIR2DL5B (untagged)-Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 5B (KIR2DL5B)


  "NM_001018081" in other vectors (6)

Reconstitution Protocol

USD 640.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "KIR2DL5B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KIR2DL5B
Synonyms KIR2DL5; KIR2DL5.2; KIR2DLX
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_001018081 edited
ATGTCGCTCATGGTCATCAGCATGGCGTGTGTTGGGTTCTTCTTGCTGCAGGGGGCCTGG
ACACATGAGGGTGGACAGGACAAGCCCTTGCTGTCTGCCTGGCCCAGCGCTGTGGTGCCT
CGAGGAGGACATGTGACTCTTCTGTGTCGCTCTCGTCTTGGGTTTACCATCTTCAGTCTG
TACAAAGAAGATGGGGTGCCTGTCCCTGAGCTCTACAACAAAATATTCTGGAAGAGCATC
CTCATGGGCCCTGTGACCCCTGCACACGCAGGGACCTACAGATGTCGGGGTTCACACCCG
CGCTCCCCCATTGAGTGGTCGGCACCCAGCAACCCCCTGGTGATCGTGGTCACAGGTCTA
TTTGGGAAACCTTCACTCTCAGCCCAGCCGGGCCCCACGGTTCGCACAGGAGAGAACGTG
GCCTTGTCCTGCAGCTCCAGGAGCTCATTTGACATGTACCATCTATCCAGGGAGGGGAGG
GCCCATGAACCTAGGCTCCCTGCAGTGCCCAGCGTCGATGGAACATTCCAGGCTGACTTT
CCTCTGGGCCCTGCCACCCACGGAGGGACCTACACATGCTTCAGCTCTCTCCATGACTCA
CCCTATGAGTGGTCAGACCCGAGTGACCCACTGCTTGTTTCTGTCACAGGAAACTCTTCA
AGTAGTTCATCTTCACCCACTGAACCAAGCTCCAAAACTGGTATCCGCAGACACCTGCAC
ATTCTGATTGGGACCTCAGTGGCTATCATCCTCTTCATCATCCTCTTCTTCTTTCTCCTT
CATTGCTGCTGCTCCAACAAAAAGAATGCTGCTGTAATGGACCAAGGGCCTGCCGGGGAC
AGAACAGTGAACAGGGAGGACTCTGATGATCAAGACCCTCAGGAGGTGACATATGCACAG
TTGGATCACTGCGTTTTCACACAGACAAAAATCACTTCCCCTTCTCAGAGGCCCAAGGCA
CCTCCAACAGATACCACCATGTACATGGAACTTCCAAATGCTAAGCCAAGATCATTGTCT
CCTGCCCATAAGCACCACAGTCAGGCCTTGAGGGGATCTTCTAGGGAGACAACAGCCCTG
TCTCAAAACCGGGTTGCTAGCTCCCATGTACCAGCAGCTGGAATCTGA
Restriction Sites Please inquire     
ACCN NM_001018081
ORF Size 1128 bp
Insert Size 1100
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001018081.1, NP_001018091.1
RefSeq Size 1632
RefSeq ORF 1128
Locus ID 553128
Protein Families Transmembrane
Gene Summary Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several "framework" genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.