KIR2DL5B (NM_001018081) Human Untagged Clone
CAT#: SC302167
KIR2DL5B (untagged)-Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 5B (KIR2DL5B)
"NM_001018081" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KIR2DL5B |
Synonyms | KIR2DL5; KIR2DL5.2; KIR2DLX |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001018081 edited
ATGTCGCTCATGGTCATCAGCATGGCGTGTGTTGGGTTCTTCTTGCTGCAGGGGGCCTGG ACACATGAGGGTGGACAGGACAAGCCCTTGCTGTCTGCCTGGCCCAGCGCTGTGGTGCCT CGAGGAGGACATGTGACTCTTCTGTGTCGCTCTCGTCTTGGGTTTACCATCTTCAGTCTG TACAAAGAAGATGGGGTGCCTGTCCCTGAGCTCTACAACAAAATATTCTGGAAGAGCATC CTCATGGGCCCTGTGACCCCTGCACACGCAGGGACCTACAGATGTCGGGGTTCACACCCG CGCTCCCCCATTGAGTGGTCGGCACCCAGCAACCCCCTGGTGATCGTGGTCACAGGTCTA TTTGGGAAACCTTCACTCTCAGCCCAGCCGGGCCCCACGGTTCGCACAGGAGAGAACGTG GCCTTGTCCTGCAGCTCCAGGAGCTCATTTGACATGTACCATCTATCCAGGGAGGGGAGG GCCCATGAACCTAGGCTCCCTGCAGTGCCCAGCGTCGATGGAACATTCCAGGCTGACTTT CCTCTGGGCCCTGCCACCCACGGAGGGACCTACACATGCTTCAGCTCTCTCCATGACTCA CCCTATGAGTGGTCAGACCCGAGTGACCCACTGCTTGTTTCTGTCACAGGAAACTCTTCA AGTAGTTCATCTTCACCCACTGAACCAAGCTCCAAAACTGGTATCCGCAGACACCTGCAC ATTCTGATTGGGACCTCAGTGGCTATCATCCTCTTCATCATCCTCTTCTTCTTTCTCCTT CATTGCTGCTGCTCCAACAAAAAGAATGCTGCTGTAATGGACCAAGGGCCTGCCGGGGAC AGAACAGTGAACAGGGAGGACTCTGATGATCAAGACCCTCAGGAGGTGACATATGCACAG TTGGATCACTGCGTTTTCACACAGACAAAAATCACTTCCCCTTCTCAGAGGCCCAAGGCA CCTCCAACAGATACCACCATGTACATGGAACTTCCAAATGCTAAGCCAAGATCATTGTCT CCTGCCCATAAGCACCACAGTCAGGCCTTGAGGGGATCTTCTAGGGAGACAACAGCCCTG TCTCAAAACCGGGTTGCTAGCTCCCATGTACCAGCAGCTGGAATCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001018081 |
ORF Size | 1128 bp |
Insert Size | 1100 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001018081.1, NP_001018091.1 |
RefSeq Size | 1632 |
RefSeq ORF | 1128 |
Locus ID | 553128 |
Protein Families | Transmembrane |
Gene Summary | Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several "framework" genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213765 | KIR2DL5B (Myc-DDK-tagged)-Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 5B (KIR2DL5B) |
USD 98.00 |
|
RG213765 | KIR2DL5B (GFP-tagged) - Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 5B (KIR2DL5B) |
USD 460.00 |
|
RC213765L1 | Lenti ORF clone of Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 5B (KIR2DL5B), Myc-DDK-tagged |
USD 768.00 |
|
RC213765L2 | Lenti ORF clone of Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 5B (KIR2DL5B), mGFP tagged |
USD 620.00 |
|
RC213765L3 | Lenti ORF clone of Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 5B (KIR2DL5B), Myc-DDK-tagged |
USD 620.00 |
|
RC213765L4 | Lenti ORF clone of Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 5B (KIR2DL5B), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review