ADIG (NM_001018082) Human Untagged Clone

CAT#: SC302168

ADIG (untagged)-Human adipogenin (ADIG)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ADIG
• Synonyms: SMAF1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001018082, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGTACCCTTTGATGCCGCTGGTGAACGACCTCACATTTTCTTTCCTGGTTTTCTGGTTCTGCCTCC
  CTGTGGGTTTGCTGTTGTTATTGATCATCTGGCTACGCTTCTTACTTAGCCAAGATTCAGAGGAAAATGA
  CTCCAGTGTGTGCTTGGATTGGGAGCCCTGGAGCAAAGGCCCAGCTGAGTTTTGCTGGAAGGGGACACTC
  CACGGCCAAGAGAAGGAGAGGCCCTGCTGGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001018082
• ORF Size: 243 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001018082.2, NP_001018092.1
• RefSeq Size: 789
• RefSeq ORF: 243
• Locus ID: 149685
• Protein Families: Transmembrane
• Gene Summary: ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation (Kim et al., 2005 [PubMed 15567149]; Hong et al., 2005 [PubMed 16132694]). [supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the conserved protein.