GCOM1 (NM_001018091) Human Untagged Clone

CAT#: SC302173

GCOM1 (untagged)-Human GRINL1A complex locus (GCOM1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GCOM1
• Synonyms: gcom; Gcom2; GRINL1A; MYZAP; MYZAP-POLR2M
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001018091, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGCGCTCCACGTCCACGGTCACCCTGCTCTCGGGCGGCGCCGCCAGGACGCCCGGGGCGCCCAGCA
  GGAGGGCAAATGTTTGCAGACTACGGCTGACCGTACCTCCTGAGAGTCCAGTTCCTGAGCAATGTGAAAA
  GAAGATTGAGAGAAAAGAGCAGCTTCTTGACCTGAGCAATGGAGAACCTACCAGGAAACTTCCTCAGGGT
  GTTGTTTATGGTGTGGTGCGAAGATCAGATCAAAATCAGCAGAAAGAAATGGTGGTGTATGGGTGGTCCA
  CCAGTCAGCTGAAAGAAGAGATGAACTACATCAAAGATGTGAGAGCCACTTTGGAAAAGGTGAGAAAGCG
  AATGTATGGAGACTATGATGAGATGAGACAGAAGATTCGACAGCTCACCCAGGAACTATCAGTTTCCCAT
  GCTCAGCAGGAGTATCTGGAGAATCACATCCAAACCCAGTCGTCTGCCCTGGATCGTTTTAATGCCATGA
  ACTCAGCCTTGGCATCAGATTCCATTGGCCTGCAGAAAACCCTCGTGGATGTGACTTTGGAAAACAGCAA
  CATTAAGGATCAAATCAGAAATCTGCAGCAGACGTATGAAGCATCCATGGACAAGCTGAGGGAAAAGCAG
  AGGCAGTTGGAGGTAGCGCAAGTTGAAAACCAGCTGCTAAAAATGAAGGTGGAATCGTCCCAAGAAGCCA
  ATGCTGAGGTGATGCGAGAGATGACCAAGAAGCTGTACAGCCAGTATGAGGAGAAGCTGCAGGAAGAACA
  GAGGAAGCACAGTGCTGAGAAGGAGGCTCTTTTGGAAGAAACCAATAGTTTTCTGAAAGCGATTGAAGAA
  GCCAATAAAAAGATGCAAGCAGCAGAGATCAGCCTAGAGGAGAAAGACCAGAGGATCGGGGAGCTGGACA
  GGCTGATTGAGCGCATGGAAAAGGAACGTCATCAACTGCAACTTCAACTCCTAGAACATGAAACAGAAAT
  GTCTGGGGAGTTAACTGATTCTGACAAGGAAAGGTATCAGCAGTTGGAGGAGGCATCAGCCAGCCTCCGT
  GAGCGGATCAGACACCTAGATGACATGGTGCATTGCCAGCAGAAGAAAGTCAAGCAGATGGTCGAGGAGA
  TTGAATCATTAAAGAAAAAGTTGCAACAGAAACAGCTCTTAATACTGCAGCTTTTAGAAAAGATATCTTT
  CTTAGAAGGAGAGAATAATGAACTACAAAGCAGGTTGGACTATTTAACAGAAACCCAGGCCAAGACCGAA
  GTGGAAACCAGAGAGATAGGAGTGGGCTGTGATCTTCTACCCAGGAGATGCAAGCAAAGCTCGCAGCGCA
  AAAATTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001018091
• ORF Size: 1338 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001018091.6, NP_001018101.1
• RefSeq Size: 4457
• RefSeq ORF: 1338
• Locus ID: 145781
• Protein Families: Druggable Genome
• Gene Summary: This locus represents naturally occurring readthrough transcription between the neighboring MYZAP (myocardial zonula adherens protein) and POLR2M (polymerase (RNA) II (DNA directed) polypeptide M) genes on chromosome 15. Alternative splicing results in multiple readthrough transcript variants. Readthrough variants may encode proteins that share sequence identity with the upstream gene product or with both the upstream and downstream gene products. Some readthrough transcript variants are also expected to be candidates for nonsense-mediated decay (NMD). [provided by RefSeq, Oct 2013]
  Transcript Variant: This variant (2, also known as Gcom2) lacks an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. The resulting isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.