GCOM1 (NM_001018091) Human Untagged Clone

CAT#: SC302173

GCOM1 (untagged)-Human GRINL1A complex locus (GCOM1), transcript variant 2


  "NM_001018091" in other vectors (6)

Reconstitution Protocol

USD 750.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GCOM1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GCOM1
Synonyms gcom; Gcom2; GRINL1A; MYZAP; MYZAP-POLR2M
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001018091, the custom clone sequence may differ by one or more nucleotides


ATGCTGCGCTCCACGTCCACGGTCACCCTGCTCTCGGGCGGCGCCGCCAGGACGCCCGGGGCGCCCAGCA
GGAGGGCAAATGTTTGCAGACTACGGCTGACCGTACCTCCTGAGAGTCCAGTTCCTGAGCAATGTGAAAA
GAAGATTGAGAGAAAAGAGCAGCTTCTTGACCTGAGCAATGGAGAACCTACCAGGAAACTTCCTCAGGGT
GTTGTTTATGGTGTGGTGCGAAGATCAGATCAAAATCAGCAGAAAGAAATGGTGGTGTATGGGTGGTCCA
CCAGTCAGCTGAAAGAAGAGATGAACTACATCAAAGATGTGAGAGCCACTTTGGAAAAGGTGAGAAAGCG
AATGTATGGAGACTATGATGAGATGAGACAGAAGATTCGACAGCTCACCCAGGAACTATCAGTTTCCCAT
GCTCAGCAGGAGTATCTGGAGAATCACATCCAAACCCAGTCGTCTGCCCTGGATCGTTTTAATGCCATGA
ACTCAGCCTTGGCATCAGATTCCATTGGCCTGCAGAAAACCCTCGTGGATGTGACTTTGGAAAACAGCAA
CATTAAGGATCAAATCAGAAATCTGCAGCAGACGTATGAAGCATCCATGGACAAGCTGAGGGAAAAGCAG
AGGCAGTTGGAGGTAGCGCAAGTTGAAAACCAGCTGCTAAAAATGAAGGTGGAATCGTCCCAAGAAGCCA
ATGCTGAGGTGATGCGAGAGATGACCAAGAAGCTGTACAGCCAGTATGAGGAGAAGCTGCAGGAAGAACA
GAGGAAGCACAGTGCTGAGAAGGAGGCTCTTTTGGAAGAAACCAATAGTTTTCTGAAAGCGATTGAAGAA
GCCAATAAAAAGATGCAAGCAGCAGAGATCAGCCTAGAGGAGAAAGACCAGAGGATCGGGGAGCTGGACA
GGCTGATTGAGCGCATGGAAAAGGAACGTCATCAACTGCAACTTCAACTCCTAGAACATGAAACAGAAAT
GTCTGGGGAGTTAACTGATTCTGACAAGGAAAGGTATCAGCAGTTGGAGGAGGCATCAGCCAGCCTCCGT
GAGCGGATCAGACACCTAGATGACATGGTGCATTGCCAGCAGAAGAAAGTCAAGCAGATGGTCGAGGAGA
TTGAATCATTAAAGAAAAAGTTGCAACAGAAACAGCTCTTAATACTGCAGCTTTTAGAAAAGATATCTTT
CTTAGAAGGAGAGAATAATGAACTACAAAGCAGGTTGGACTATTTAACAGAAACCCAGGCCAAGACCGAA
GTGGAAACCAGAGAGATAGGAGTGGGCTGTGATCTTCTACCCAGGAGATGCAAGCAAAGCTCGCAGCGCA
AAAATTAG


Restriction Sites SgfI-MluI     
ACCN NM_001018091
ORF Size 1338 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001018091.6, NP_001018101.1
RefSeq Size 4457
RefSeq ORF 1338
Locus ID 145781
Protein Families Druggable Genome
Gene Summary This locus represents naturally occurring readthrough transcription between the neighboring MYZAP (myocardial zonula adherens protein) and POLR2M (polymerase (RNA) II (DNA directed) polypeptide M) genes on chromosome 15. Alternative splicing results in multiple readthrough transcript variants. Readthrough variants may encode proteins that share sequence identity with the upstream gene product or with both the upstream and downstream gene products. Some readthrough transcript variants are also expected to be candidates for nonsense-mediated decay (NMD). [provided by RefSeq, Oct 2013]
Transcript Variant: This variant (2, also known as Gcom2) lacks an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. The resulting isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.