GCOM1 (POLR2M) (NM_001018102) Human Untagged Clone

CAT#: SC302184

POLR2M (untagged)-Human glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A (GRINL1A), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: POLR2M
• Synonyms: GCOM1; Gdown; Gdown1; GRINL1A
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001018102, the custom clone sequence may differ by one or more nucleotides
  ATGTGCTCGCTGCCCCGCGGCTTCGAGCCCCAAGCTCCCGAGGACTTGGCGCAGCGGAGT
  TTGGTGGAGCTGCGGGAAATGTTGAAGCGCCAGGAGAGACTTTTGCGCAACGAGTTACAG
  AGGATCACCATTGCGGACCAAGGTGAACAACAGTCAGAAGAAAACGCAAGTACTAAGAAC
  TTGACAGGCCTTTCCAGTGGGACTGAGAAGAAACCTCATTACATGGAAGTGCTAGAAATG
  CGAGCCAAAAACCCAGTGCCCCAGCTGCGTAAATTTAAAACCAATGTGTTACCTTTTCGA
  CAAAATGATTCATCTAGTCATTGCCAGAAGAGTGGGTCTCCTATTTCCTCAGAAGAGCGG
  CGGCGCAGGGATAAGCAGCATCTTGATGACATCACAGCAGCTCGGCTTCTACCACTTCAC
  CATATGCCCACGCAGCTGCTCTCCATAGAAGAATCCTTGGCACTTCAGAAACAGCAGAAA
  CAGAATTATGAGGAGATGCAAGCAAAGCTCGCAGCGCAAAAATTAGCTGAAAGACTGAAT
  ATTAAAATGCGGAGTTATAATCCAGAAGGGGAGTCTTCAGGGAGATACCGAGAAGTAAGG
  GATGAAGATGACGATTGGTCCTCTGATGAATTCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001018102
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001018102.1, NP_001018112.1
• RefSeq Size: 3668 bp
• RefSeq ORF: 636 bp
• Locus ID: 81488
• Cytogenetics: 15q21.3
• Protein Families: Druggable Genome, Ion Channels: Other
• Gene Summary: This gene encodes a subunit of a specific form of RNA polymerase II termed Pol II(G). The encoded protein may act as a negative regulator of transcriptional activation by the Mediator complex. Alternative splicing results in multiple transcript variants. There is a pseudogene for this gene on chromosome 4. Readthrough transcription between this gene and the neighboring upstream gene MYZAP (myocardial zonula adherens protein) is represented with GeneID 145781. [provided by RefSeq, Oct 2013]
  Transcript Variant: This variant (2, also known as Gdown6) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. The resulting isoform (2) is shorter than isoform 1.