MRP5 (ABCC5) (NM_001023587) Human Untagged Clone

CAT#: SC302224

ABCC5 (untagged)-Human ATP-binding cassette, sub-family C (CFTR/MRP), member 5 (ABCC5), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ABCC5
• Synonyms: ABC33; EST277145; MOAT-C; MOATC; MRP5; pABC11; SMRP
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001023587 edited
  GAACCTCCACTCAGAGAAGATGAAGGATATCGACATAGGAAAAGAGTATATCATCCCCAG
  TCCTGGGTATAGAAGTGTGAGGGAGAGAACCAGCACTTCTGGGACGCACAGAGACCGTGA
  AGATTCCAAGTTCAGGAGAACTCGACCGTTGGAATGCCAAGATGCCTTGGAAACAGCAGC
  CCGAGCCGAGGGCCTCTCTCTTGATGCCTCCATGCATTCTCAGCTCAGAATCCTGGATGA
  GGAGCATCCCAAGGGAAAGTACCATCATGGCTTGAGTGCTCTGAAGCCCATCCGGACTAC
  TTCCAAACACCAGCACCCAGTGGACAATGCTGGGCTTTTTTCCTGTATGACTTTTTCGTG
  GCTTTCTTCTCTGGCCCGTGTGGCCCACAAGAAGGGGGAGCTCTCAATGGAAGACGTGTG
  GTCTCTGTCCAAGCACGAGTCTTCTGACGTGAACTGCAGAAGACTAGAGAGACTGTGGCA
  AGAAGAGCTGAATGAAGTTGGGCCAGACGCTGCTTCCCTGCGAAGGGTTGTGTGGATCTT
  CTGCCGCACCAGGCTCATCCTGTCCATCGTGTGCCTGATGATCACGCAGCTGGCTGGCTT
  CAGTGGACCAAATTTTCAGGATGGCTGTATTCTGCGGTCAGAATGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001023587
• ORF Size: 627 bp
• Insert Size: 600
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001023587.1.

Reference Data

• RefSeq: NM_001023587.1, NP_001018881.1
• RefSeq Size: 2007
• RefSeq ORF: 627
• Locus ID: 10057
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: ABC transporters
• Gene Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions in the cellular export of its substrate, cyclic nucleotides. This export contributes to the degradation of phosphodiesterases and possibly an elimination pathway for cyclic nucleotides. Studies show that this protein provides resistance to thiopurine anticancer drugs, 6-mercatopurine and thioguanine, and the anti-HIV drug 9-(2-phosphonylmethoxyethyl)adenine. This protein may be involved in resistance to thiopurines in acute lymphoblastic leukemia and antiretroviral nucleoside analogs in HIV-infected patients. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
  Transcript Variant: This variant (2) lacks several exons and contains an alternate 3' structure, compared to variant 1. It encodes isoform 2 which is shorter and has a distinct C-terminus, compared to isoform 1.