S100 Calcium Binding Protein A13 (S100A13) (NM_001024212) Human Untagged Clone

CAT#: SC302234

S100A13 (untagged)-Human S100 calcium binding protein A13 (S100A13), transcript variant 4


  "NM_001024212" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "S100A13"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol S100A13
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001024212, the custom clone sequence may differ by one or more nucleotides
ATGGCAGCAGAACCACTGACAGAGCTAGAGGAGTCCATTGAGACCGTGGTCACCACCTTC
TTCACCTTTGCAAGGCAGGAGGGCCGGAAGGATAGCCTCAGCGTCAACGAGTTCAAAGAG
CTGGTTACCCAGCAGTTGCCCCATCTGCTCAAGGATGTGGGCTCTCTTGATGAGAAGATG
AAGAGCTTGGATGTGAATCAGGACTCGGAGCTCAAGTTCAATGAGTACTGGAGATTGATT
GGGGAGCTGGCCAAGGAAATCAGGAAGAAGAAAGACCTGAAGATCAGGAAGAAGTAA
Restriction Sites Please inquire     
ACCN NM_001024212
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001024212.1, NP_001019383.1
RefSeq Size 638 bp
RefSeq ORF 297 bp
Locus ID 6284
Cytogenetics 1q21.3
Protein Families Druggable Genome
Gene Summary 'The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein is widely expressed in various types of tissues with a high expression level in thyroid gland. In smooth muscle cells, this protein co-expresses with other family members in the nucleus and in stress fibers, suggesting diverse functions in signal transduction. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (4) has a distinct and shorter 5' UTR, as compared to variant 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.