HMBS (NM_001024382) Human Untagged Clone

CAT#: SC302245

HMBS (untagged)-Human hydroxymethylbilane synthase (HMBS), transcript variant 2


  "NM_001024382" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "HMBS"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HMBS
Synonyms PBG-D; PBGD; PORC; UPS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001024382, the custom clone sequence may differ by one or more nucleotides


ATGAGAGTGATTCGCGTGGGTACCCGCAAGAGCCAGCTTGCTCGCATACAGACGGACAGTGTGGTGGCAA
CATTGAAAGCCTCGTACCCTGGCCTGCAGTTTGAAATCATTGCTATGTCCACCACAGGGGACAAGATTCT
TGATACTGCACTCTCTAAGATTGGAGAGAAAAGCCTGTTTACCAAGGAGCTTGAACATGCCCTGGAGAAG
AATGAAGTGGACCTGGTTGTTCACTCCTTGAAGGACCTGCCCACTGTGCTTCCTCCTGGCTTCACCATCG
GAGCCATCTGCAAGCGGGAAAACCCTCATGATGCTGTTGTCTTTCACCCAAAATTTGTTGGGAAGACCCT
AGAAACCCTGCCAGAGAAGAGTGTGGTGGGAACCAGCTCCCTGCGAAGAGCAGCCCAGCTGCAGAGAAAG
TTCCCGCATCTGGAGTTCAGGAGTATTCGGGGAAACCTCAACACCCGGCTTCGGAAGCTGGACGAGCAGC
AGGAGTTCAGTGCCATCATCCTGGCAACAGCTGGCCTGCAGCGCATGGGCTGGCACAACCGGGTGGGGCA
GATCCTGCACCCTGAGGAATGCATGTATGCTGTGGGCCAGGGGGCCTTGGGCGTGGAAGTGCGAGCCAAG
GACCAGGACATCTTGGATCTGGTGGGTGTGCTGCACGATCCCGAGACTCTGCTTCGCTGCATCGCTGAAA
GGGCCTTCCTGAGGCACCTGGAAGGAGGCTGCAGTGTGCCAGTAGCCGTGCATACAGCTATGAAGGATGG
GCAACTGTACCTGACTGGAGGAGTCTGGAGTCTAGACGGCTCAGATAGCATACAAGAGACCATGCAGGCT
ACCATCCATGTCCCTGCCCAGCATGAAGATGGCCCTGAGGATGACCCACAGTTGGTAGGCATCACTGCTC
GTAACATTCCACGAGGGCCCCAGTTGGCTGCCCAGAACTTGGGCATCAGCCTGGCCAACTTGTTGCTGAG
CAAAGGAGCCAAAAACATCCTGGATGTTGCACGGCAGCTTAACGATGCCCATTAA


Restriction Sites SgfI-MluI     
ACCN NM_001024382
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001024382.1, NP_001019553.1
RefSeq Size 1428 bp
RefSeq ORF 1035 bp
Locus ID 3145
Cytogenetics 11q23.3
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Porphyrin and chlorophyll metabolism
Gene Summary 'This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (2) contains an alternate, in-frame exon in the 5' coding region and uses a downstream start codon, compared to variant 1. It encodes isoform 2, which has a shorter N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.