HES3 (NM_001024598) Human Untagged Clone
CAT#: SC302258
HES3 (untagged)-Human hairy and enhancer of split 3 (Drosophila) (HES3)
"NM_001024598" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HES3 |
Synonyms | bHLHb43 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001024598 edited
ATGGAGAAAAAGCGCCGGGCACGCATCAATGTGTCACTGGAGCAGCTCAAGTCGCTGCTG GAGAAACACTACTCGCACCAGATCCGGAAGCGCAAATTGGAGAAGGCCGACATCCTGGAG TTGAGCGTGAAGTACATGAGAAGCCTTCAGAACTCCTTGCAAGGGCTCTGGCCTGTGCCC AGGGGAGCCGAGCAACCGTCGGGCTTCCGCAGCTGCCTGCCCGGCGTGAGCCAGCTCCTT CGGCGCGGAGATGAGGTCGGCAGCGGCCTGCGCTGCCCCCTGGTGCCCGAGAGCGCCGCC GGCAGCACCATGGACAGCGCCGGGTTGGGCCAGGAGGCGCCCGCGCTGTTCCGCCCTTGC ACCCCTGCCGTCTGGGCTCCTGCTCCGGCCGCCGGCGGCCCGCGGTCCCCACCACCCCTG CTCCTCCTCCCCGAAAGTCTCCCTGGCTCGTCCGCCAGCGTCCCCCCGCCGCAGCCAGCG TCGAGTCGCTGCGCCGAGAGTCCCGGGCTGGGCCTGCGCGTGTGGCGGCCCTGGGGAAGC CCCGGGGATGACCTGAACTGA |
Restriction Sites | Please inquire |
ACCN | NM_001024598 |
ORF Size | 561 bp |
Insert Size | 600 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001024598.1, NP_001019769.1 |
RefSeq Size | 1355 |
RefSeq ORF | 561 |
Locus ID | 390992 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224630 | HES3 (Myc-DDK-tagged)-Human hairy and enhancer of split 3 (Drosophila) (HES3) |
USD 420.00 |
|
RG224630 | HES3 (GFP-tagged) - Human hairy and enhancer of split 3 (Drosophila) (HES3) |
USD 460.00 |
|
RC224630L1 | Lenti ORF clone of Human hairy and enhancer of split 3 (Drosophila) (HES3), Myc-DDK-tagged |
USD 768.00 |
|
RC224630L2 | Lenti ORF clone of Human hairy and enhancer of split 3 (Drosophila) (HES3), mGFP tagged |
USD 620.00 |
|
RC224630L3 | Lenti ORF clone of Human hairy and enhancer of split 3 (Drosophila) (HES3), Myc-DDK-tagged |
USD 620.00 |
|
RC224630L4 | Lenti ORF clone of Human hairy and enhancer of split 3 (Drosophila) (HES3), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review