Bcl 7A (BCL7A) (NM_001024808) Human Untagged Clone

CAT#: SC302300

BCL7A (untagged)-Human B-cell CLL/lymphoma 7A (BCL7A), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BCL7A
• Synonyms: BCL7
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001024808, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCGGGCAGGTCGGTTCGAGCCGAGACGAGGAGCCGGGCCAAAGATGATATCAAGAGGGTCATGGCGG
  CGATCGAGAAAGTGCGCAAATGGGAGAAGAAATGGGTGACCGTTGGTGACACATCCCTACGAATCTACAA
  ATGGGTCCCTGTGACGGAGCCCAAGGTTGATGACAAAAACAAGAATAAGAAAAAAGGCAAGGACGAGAAG
  TGTGGCTCAGAGGTGACCACTCCGGAGAACAGTTCCTCCCCAGGGATGATGGACATGCATGACGATAACA
  GCAACCAGAGCTCCATCGCAGATGCCTCCCCCATCAAACAGGAGAACAGCAGCAACTCCAGCCCCGCTCC
  AGAGCCCAACTCGGCTGTGCCCAGCGACGGCACCGAGGCCAAGGTGGATGAGGCCCAGGCTGATGGGAAG
  GAGCACCCAGGAGCTGAAGATGCTTCTGATGAGCAGAATTCACAGTCCTCGATGGAACATTCGATGAACA
  GCTCAGAGAAAGTAGATCGGCAGCCGTCTGGAGACTCGGGTCTGGCCGCAGAGACGTCTGCAATCTCTCA
  GGATTTGGAAGGAGTGCCACCCTCTAAAAAGATGAAACTGGAGGCCTCTCAACAAAACTCCGAAGAGATG
  TAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001024808
• ORF Size: 633 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001024808.2, NP_001019979.1
• RefSeq Size: 3720
• RefSeq ORF: 633
• Locus ID: 605
• Protein Families: Druggable Genome
• Gene Summary: This gene is directly involved, with Myc and IgH, in a three-way gene translocation in a Burkitt lymphoma cell line. As a result of the gene translocation, the N-terminal region of the gene product is disrupted, which is thought to be related to the pathogenesis of a subset of high-grade B cell non-Hodgkin lymphoma. The N-terminal segment involved in the translocation includes the region that shares a strong sequence similarity with those of BCL7B and BCL7C. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.