ARPP21 (NM_001025068) Human Untagged Clone
CAT#: SC302331
ARPP21 (untagged)-Human cAMP-regulated phosphoprotein, 21kDa (ARPP21), transcript variant 3
"NM_001025068" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ARPP21 |
Synonyms | ARPP-21; R3HDM3; RCS; TARPP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001025068, the custom clone sequence may differ by one or more nucleotides
ATGTCTGAGCAAGGAGACCTGAATCAGGCAATAGCAGAGGAAGGAGGGACTGAGCAGGAGACGGCCACTC CAGAGAACGGCATTGTTAAATCAGAAAGTCTGGATGAAGAGGAGAAACTGGAACTGCAGAGGCGGCTGGA GGCTCAGAATCAAGAAAGAAGAAAATCCAAGTCAGGAGCAGGAAAAGGTAAACTGACTCGCAGCCTTGCT GTCTGTGAGGAATCTTCTGCCAGACCAGGAGGTGAAAGTCTTCAGGATCAGACTCTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001025068 |
ORF Size | 270 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001025068.1, NP_001020239.1 |
RefSeq Size | 2409 |
RefSeq ORF | 270 |
Locus ID | 10777 |
Gene Summary | This gene encodes a cAMP-regulated phosphoprotein. The encoded protein is enriched in the caudate nucleus and cerebellar cortex. A similar protein in mouse may be involved in regulating the effects of dopamine in the basal ganglia. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012] Transcript Variant: This variant (3) uses two alternate 5' exons and an alternate 3' exon compared to variant 1. The resulting isoform (2) has a distinct and much shorter C-terminus compared to isoform 1. Variants 2, 3, 4, 5 and 7 all encode the same isoform (2). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218239 | ARPP21 (Myc-DDK-tagged)-Human cAMP-regulated phosphoprotein, 21kDa (ARPP21), transcript variant 3 |
USD 420.00 |
|
RG218239 | ARPP21 (GFP-tagged) - Human cAMP-regulated phosphoprotein, 21kDa (ARPP21), transcript variant 3 |
USD 460.00 |
|
RC218239L1 | Lenti ORF clone of Human cAMP-regulated phosphoprotein, 21kDa (ARPP21), transcript variant 3, Myc-DDK-tagged |
USD 768.00 |
|
RC218239L2 | Lenti ORF clone of Human cAMP-regulated phosphoprotein, 21kDa (ARPP21), transcript variant 3, mGFP tagged |
USD 620.00 |
|
RC218239L3 | Lenti ORF clone of Human cAMP-regulated phosphoprotein, 21kDa (ARPP21), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC218239L4 | Lenti ORF clone of Human cAMP-regulated phosphoprotein, 21kDa (ARPP21), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review