ARPP21 (NM_001025068) Human Untagged Clone

CAT#: SC302331

ARPP21 (untagged)-Human cAMP-regulated phosphoprotein, 21kDa (ARPP21), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ARPP21
• Synonyms: ARPP-21; R3HDM3; RCS; TARPP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001025068, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCTGAGCAAGGAGACCTGAATCAGGCAATAGCAGAGGAAGGAGGGACTGAGCAGGAGACGGCCACTC
  CAGAGAACGGCATTGTTAAATCAGAAAGTCTGGATGAAGAGGAGAAACTGGAACTGCAGAGGCGGCTGGA
  GGCTCAGAATCAAGAAAGAAGAAAATCCAAGTCAGGAGCAGGAAAAGGTAAACTGACTCGCAGCCTTGCT
  GTCTGTGAGGAATCTTCTGCCAGACCAGGAGGTGAAAGTCTTCAGGATCAGACTCTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001025068
• ORF Size: 270 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001025068.1, NP_001020239.1
• RefSeq Size: 2409
• RefSeq ORF: 270
• Locus ID: 10777
• Gene Summary: This gene encodes a cAMP-regulated phosphoprotein. The encoded protein is enriched in the caudate nucleus and cerebellar cortex. A similar protein in mouse may be involved in regulating the effects of dopamine in the basal ganglia. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
  Transcript Variant: This variant (3) uses two alternate 5' exons and an alternate 3' exon compared to variant 1. The resulting isoform (2) has a distinct and much shorter C-terminus compared to isoform 1. Variants 2, 3, 4, 5 and 7 all encode the same isoform (2).