Cytochrome P450 2D6 (CYP2D6) (NM_001025161) Human Untagged Clone

CAT#: SC302357

CYP2D6 (untagged)-Human cytochrome P450, family 2, subfamily D, polypeptide 6 (CYP2D6), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CYP2D6
• Synonyms: CPD6; CYP2D; CYP2D7AP; CYP2D7BP; CYP2D7P2; CYP2D8P2; CYP2DL1; CYPIID6; P450-DB1; P450C2D; P450DB1
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001025161 edited
  ATGGGGCTAGAAGCACTGGTGCCCCTGGCCATGATAGTGGCCATCTTCCTGCTCCTGGTG
  GACCTGATGCACCGGCGCCAACGCTGGGCTGCACGCTACCCACCAGGCCCCCTGCCACTG
  CCCGGGCTGGGCAACCTGCTGCATGTGGACTTCCAGAACACACCATACTGCTTCGACCAG
  TTGCGGCGCCGCTTCGGGGACGTGTTCAGCCTGCAGCTGGCCTGGACGCCGGTGGTCGTG
  CTCAATGGGCTGGCGGCCGTGCGCGAGGCGCTGGTGACCCACGGCGAGGACACCGCCGAC
  CGCCCGCCTGTGCCCATCACCCAGATCCTGGGTTTCGGGCCGCGTTCCCAAGGACGCCCC
  TTTCGCCCCAACGGTCTCTTGGACAAAGCCGTGAGCAACGTGATCGCCTCCCTCACCTGC
  GGGCGCCGCTTCGAGTACGACGACCCTCGCTTCCTCAGGCTGCTGGACCTAGCTCAGGAG
  GGACTGAAGGAGGAGTCGGGCTTTCTGCGCGAGGTGCTGAATGCTGTCCCCGTCCTCCTG
  CATATCCCAGCGCTGGCTGGCAAGGTCCTACGCTTCCAAAAGGCTTTCCTGACCCAGCTG
  GATGAGCTGCTAACTGAGCACAGGATGACCTGGGACCCAGCCCAGCCCCCCCGAGACCTG
  ACTGAGGCCTTCCTGGCAGAGATGGAGAAGGCCAAGGGGAACCCTGAGAGCAGCTTCAAT
  GATGAGAACCTGTGCATAGTGGTGGCTGACCTGTTCTCTGCCGGGATGGTGACCACCTCG
  ACCACGCTGGCCTGGGGCCTCCTGCTCATGATCCTACATCCGGATGTGCAGCGCCGTGTC
  CAACAGGAGATCGACGACGTGATAGGGCAGGTGCGGCGACCAGAGATGGGTGACCAGGCT
  CACATGCCCTACACCACTGCCGTGATTCATGAGGTGCAGCGCTTTGGGGACATCGTCCCC
  CTGGGTGTGACCCATATGACATCCCGTGACATCGAAGTACAGGGCTTCCGCATCCCTAAG
  GGAACGACACTCATCACCAACCTGTCATCGGTGCTGAAGGATGAGGCCGTCTGGGAGAAG
  CCCTTCCGCTTCCACCCCGAACACTTCCTGGATGCCCAGGGCCACTTTGTGAAGCCGGAG
  GCCTTCCTGCCTTTCTCAGCAGGCCGCCGTGCATGCCTCGGGGAGCCCCTGGCCCGCATG
  GAGCTCTTCCTCTTCTTCACCTCCCTGCTGCAGCACTTCAGCTTCTCGGTGCCCACTGGA
  CAGCCCCGGCCCAGCCACCATGGTGTCTTTGCTTTCCTGGTGACCCCATCCCCCTATGAG
  CTTTGTGCTGTGCCCCGCTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001025161
• Insert Size: 1300 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001025161.1, NP_001020332.1
• RefSeq Size: 1520 bp
• RefSeq ORF: 1341 bp
• Locus ID: 1565
• Cytogenetics: 22q13.2
• Protein Families: Druggable Genome, P450, Transmembrane
• Protein Pathways: Drug metabolism - cytochrome P450
• Gene Summary: 'This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is known to metabolize as many as 25% of commonly prescribed drugs. Its substrates include antidepressants, antipsychotics, analgesics and antitussives, beta adrenergic blocking agents, antiarrythmics and antiemetics. The gene is highly polymorphic in the human population; certain alleles result in the poor metabolizer phenotype, characterized by a decreased ability to metabolize the enzyme's substrates. Some individuals with the poor metabolizer phenotype have no functional protein since they carry 2 null alleles whereas in other individuals the gene is absent. This gene can vary in copy number and individuals with the ultrarapid metabolizer phenotype can have 3 or more active copies of the gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]'
  Transcript Variant: This variant (2) lacks an in-frame exon in the CDS, as compared to variant 1, which results in a shorter isoform (2).