TSPAN4 (NM_001025236) Human Untagged Clone

CAT#: SC302375

TSPAN4 (untagged)-Human tetraspanin 4 (TSPAN4), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TSPAN4
• Synonyms: NAG-2; NAG2; TETRASPAN; TM4SF7; TSPAN-4
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001025236, the custom clone sequence may differ by one or more nucleotides
  ATGGCGCGCGCCTGCCTCCAGGCCGTCAAGTACCTCATGTTCGCCTTCAACCTGCTCTTC
  TGGCTGGGAGGCTGTGGCGTGCTGGGTGTCGGCATCTGGCTGGCCGCCACACAGGGGAGC
  TTCGCCACGCTGTCCTCTTCCTTCCCGTCCCTGTCGGCTGCCAACTTGCTCATCATCACC
  GGCGCCTTTGTCATGGCCATCGGCTTCGTGGGCTGCCTGGGTGCCATCAAGGAGAACAAG
  TGCCTCCTGCTCACTTTCTTCCTGCTGCTGCTGCTGGTGTTCCTGCTGGAGGCCACCATC
  GCCATCCTCTTCTTCGCCTACACGGACAAGATTGACAGGTATGCCCAGCAAGACCTGAAG
  AAAGGCTTGCACCTGTACGGCACGCAGGGCAACGTGGGCCTCACCAACGCCTGGAGCATC
  ATCCAGACCGACTTCCGCTGCTGTGGCGTCTCCAACTACACTGACTGGTTCGAGGTGTAC
  AACGCCACGCGGGTACCTGACTCCTGCTGCTTGGAGTTCAGTGAGAGCTGTGGGCTGCAC
  GCCCCCGGCACCTGGTGGAAGGCGCCGTGCTACGAGACGGTGAAGGTGTGGCTTCAGGAG
  AACCTGCTGGCTGTGGGCATCTTTGGGCTGTGCACGGCGCTGGTGCAGATCCTGGGCCTG
  ACCTTCGCCATGACCATGTACTGCCAAGTGGTCAAGGCAGACACCTACTGCGCGTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001025236
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001025236.1, NP_001020407.1
• RefSeq Size: 1447 bp
• RefSeq ORF: 717 bp
• Locus ID: 7106
• Cytogenetics: 11p15.5
• Protein Families: Transmembrane
• Gene Summary: 'The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein and is similar in sequence to its family member CD53 antigen. It is known to complex with integrins and other transmembrane 4 superfamily proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. Variants 1, 2, 3, 4, 5 and 6 encode the same isoform (a).