TAF5L (NM_001025247) Human Untagged Clone

CAT#: SC302381

TAF5L (untagged)-Human TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa (TAF5L), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TAF5L
• Synonyms: PAF65B
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001025247, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAACGAGTGCGTACCGAGCAGATTCAGATGGCAGTGTCCTGCTACCTCAAACGCCGGCAGTACGTGG
  ACTCAGATGGTCCCCTGAAGCAAGGACTGCGGCTGTCACAGACTGCTGAAGAGATGGCGGCCAATCTAAC
  AGTGCAATCAGAATCTGGTTGTGCCAACATAGTGTCTGCAGCCCCTTGCCAGGCAGAACCCCAGCAATAT
  GAAGTACAGTTTGGACGACTGCGGAATTTTCTCACTGATTCTGATTCCCAGCATAGCCACGAAGTGATGC
  CTCTCCTCTATCCTCTCTTTGTCTACCTCCATCTCAACCTGGTCCAAAACAGTCCGAAGAGCACAGTGGA
  AAGTTTTTACAGCCGCTTCCATGGAATGTTTCTGCAGAATGCTAGCCAGAAGGATGTCATTGAGCAGCTA
  CAGACCACTCAAACCATCCAGGACATCCTATCTAACTTCAAGCTTCGAGCATTCCTAGATAACAAGTACG
  TGGTCCGTCTCCAAGAAGACAGCTACAACTACCTTATCCGCTACCTCCAAAGTGACAACAATACTGCCCT
  GTGCAAAGTCCTCACCTTACATATTCATCTTGACGTGCAGCCTGCCAAGAGAACAGACTATCAGCTGTAT
  GCCAGTGGCAGCTCCTCCCGCAGTGAGAACAACGGTTTGGAGCCCCCCGACATGCCCAGCCCTATTCTGC
  AGAACGAGGCTGCCCTAGAGGTCTTACAGGAGAGCATTAAGCGAGTCAAGGATGGGCCTCCCTCCCTCAC
  TACCATCTGCTTCTATGCCTTCTATAACACAGAGCAGCTGTTGAACACTGCAGAAATCTCCCCCGATAGC
  AAGCTGCTTGCTGCTGGGTTTGACAACTCCTGTATAAAACTTTGGAGTTTACGATCCAAGAAGTTAAAAT
  CAGAGCCCCACCAAGTAGACGTGTCCCGCATCCATTTGGCTTGTGATATTCTGGAGGAGGAGGTATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001025247
• ORF Size: 978 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001025247.1, NP_001020418.1
• RefSeq Size: 4139
• RefSeq ORF: 978
• Locus ID: 27097
• Protein Families: Transcription Factors
• Protein Pathways: Basal transcription factors
• Gene Summary: The product of this gene belongs to the WD-repeat TAF5 family of proteins. This gene encodes a protein that is a component of the PCAF histone acetylase complex. The PCAF histone acetylase complex, which is composed of more than 20 polypeptides some of which are TAFs, is required for myogenic transcription and differentiation. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors to facilitate complex assembly and transcription initiation. The encoded protein is structurally similar to one of the histone-like TAFs, TAF5. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) differs in the 5' UTR and the 5' coding region, compared to variant 1. The resulting isoform (b) contains a distinct N-terminus, compared to isoform a.