WDR45 (NM_001029896) Human Untagged Clone

CAT#: SC302466

WDR45 (untagged)-Human WD repeat domain 45 (WDR45), transcript variant 2


  "NM_001029896" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "WDR45"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol WDR45
Synonyms JM5; NBIA4; NBIA5; WDRX1; WIPI-4; WIPI4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001029896, the custom clone sequence may differ by one or more nucleotides


ATGACTCAACAGCCACTTCGAGGAGTGACCAGCCTGCGTTTCAACCAAGACCAAAGCTGCTTTTGCTGCG
CCATGGAGACAGGTGTGCGCATCTACAACGTGGAGCCCTTGATGGAGAAGGGGCATCTGGACCACGAGCA
GGTGGGCAGCATGGGCTTGGTGGAGATGCTGCACCGCTCCAACCTTCTGGCCTTGGTGGGCGGTGGTAGT
AGTCCCAAGTTCTCAGAGATCTCAGTGCTGATCTGGGACGATGCCCGGGAGGGCAAGGACTCCAAGGAGA
AGCTGGTGCTGGAGTTCACCTTCACCAAGCCAGTGCTTTCTGTGCGCATGCGCCATGACAAGATCGTGAT
CGTGCTGAAGAACCGCATCTATGTGTACTCCTTCCCCGACAATCCCCGAAAGCTGTTTGAGTTTGATACC
CGGGACAACCCCAAGGGGCTCTGTGACCTCTGCCCCAGCCTGGAGAAGCAACTGCTAGTGTTCCCGGGAC
ACAAGTGTGGGAGTCTGCAACTTGTGGACCTGGCGAGCACAAAGCCTGGCACCTCGTCTGCTCCATTCAC
GATCAATGCACATCAGAGTGACATAGCCTGTGTGTCTCTAAACCAGCCAGGCACTGTAGTGGCCTCAGCC
TCCCAGAAGGGTACCCTTATTCGCCTCTTTGACACACAATCCAAGGAGAAACTGGTGGAGCTGCGCCGAG
GCACTGACCCTGCCACCCTCTACTGCATTAACTTCAGCCACGACTCCTCCTTCCTCTGCGCTTCCAGTGA
TAAGGGTACTGTCCATATCTTTGCTCTCAAGGATACCCGCCTCAACCGCCGCTCCGCGCTGGCTCGCGTG
GGCAAGGTGGGGCCTATGATTGGGCAGTACGTGGACTCTCAGTGGAGCCTGGCGAGCTTCACTGTGCCTG
CTGAGTCAGCTTGCATCTGCGCCTTCGGTCGCAATACTTCCAAGAACGTCAACTCTGTCATTGCCATCTG
CGTAGATGGGACCTTCCACAAATATGTCTTCACTCCTGATGGAAACTGCAACAGAGAGGCTTTCGACGTG
TACCTTGACATCTGTGATGATGATGACTTTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001029896
ORF Size 1083 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001029896.1, NP_001025067.1
RefSeq Size 1655
RefSeq ORF 1083
Locus ID 11152
Gene Summary This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene has a pseudogene at chromosome 4q31.3. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene, but the biological validity and full-length nature of some variants have not been determined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) has an alternate 5' UTR and lacks a 3-nt segment in the CDS, as compared to variant 1. The encoded isoform 2 thus lacks an internal amino acid, as compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.