HNF 4 alpha (HNF4A) (NM_001030003) Human Untagged Clone
CAT#: SC302485
HNF4A (untagged)-Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 5
"NM_001030003" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | HNF4A |
| Synonyms | FRTS4; HNF4; HNF4a7; HNF4a8; HNF4a9; HNF4alpha; MODY; MODY1; NR2A1; NR2A21; TCF; TCF14 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001030003 edited
ATGGTCAGCGTGAACGCGCCCCTCGGGGCTCCAGTGGAGAGTTCTTACGACACGTCCCCA TCAGAAGGCACCAACCTCAACGCGCCCAACAGCCTGGGTGTCAGCGCCCTGTGTGCCATC TGCGGGGACCGGGCCACGGGCAAACACTACGGTGCCTCGAGCTGTGACGGCTGCAAGGGC TTCTTCCGGAGGAGCGTGCGGAAGAACCACATGTACTCCTGCAGATTTAGCCGGCAGTGC GTGGTGGACAAAGACAAGAGGAACCAGTGCCGCTACTGCAGGCTCAAGAAATGCTTCCGG GCTGGCATGAAGAAGGAAGCCGTCCAGAATGAGCGGGACCGGATCAGCACTCGAAGGTCA AGCTATGAGGACAGCAGCCTGCCCTCCATCAATGCGCTCCTGCAGGCGGAGGTCCTGTCC CGACAGATCACCTCCCCCGTCTCCGGGATCAACGGCGACATTCGGGCGAAGAAGATTGCC AGCATCGCAGATGTGTGTGAGTCCATGAAGGAGCAGCTGCTGGTTCTCGTTGAGTGGGCC AAGTACATCCCAGCTTTCTGCGAGCTCCCCCTGGACGACCAGGTGGCCCTGCTCAGAGCC CATGCTGGCGAGCACCTGCTGCTCGGAGCCACCAAGAGATCCATGGTGTTCAAGGACGTG CTGCTCCTAGGCAATGACTACATTGTCCCTCGGCACTGCCCGGAGCTGGCGGAGATGAGC CGGGTGTCCATACGCATCCTTGACGAGCTGGTGCTGCCCTTCCAGGAGCTGCAGATCGAT GACAATGAGTATGCCTACCTCAAAGCCATCATCTTCTTTGACCCAGATGCCAAGGGGCTG AGCGATCCAGGGAAGATCAAGCGGCTGCGTTCCCAGGTGCAGGTGAGCTTGGAGGACTAC ATCAACGACCGCCAGTATGACTCGCGTGGCCGCTTTGGAGAGCTGCTGCTGCTGCTGCCC ACCTTGCAGAGCATCACCTGGCAGATGATCGAGCAGATCCAGTTCATCAAGCTCTTCGGC ATGGCCAAGATTGACAACCTGTTGCAGGAGATGCTGCTGGGAGGGTCCCCCAGCGATGCA CCCCATGCCCACCACCCCCTGCACCCTCACCTGATGCAGGAACATATGGGAACCAACGTC ATCGTTGCCAACACAATGCCCACTCACCTCAGCAACGGACAGATGTCCACCCCTGAGACC CCACAGCCCTCACCGCCAGGTGGCTCAGGGTCTGAGCCCTATAAGCTCCTGCCGGGAGCC GTCGCCACAATCGTCAAGCCCCTCTCTGCCATCCCCCAGCCGACCATCACCAAGCAGGAA GTTATCTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001030003 |
| Insert Size | 1300 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001030003.1. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001030003.1, NP_001025174.1 |
| RefSeq Size | 1339 bp |
| RefSeq ORF | 1329 bp |
| Locus ID | 3172 |
| Cytogenetics | 20q13.12 |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Nuclear Hormone Receptor, Transcription Factors |
| Protein Pathways | Maturity onset diabetes of the young |
| Gene Summary | 'The protein encoded by this gene is a nuclear transcription factor which binds DNA as a homodimer. The encoded protein controls the expression of several genes, including hepatocyte nuclear factor 1 alpha, a transcription factor which regulates the expression of several hepatic genes. This gene may play a role in development of the liver, kidney, and intestines. Mutations in this gene have been associated with monogenic autosomal dominant non-insulin-dependent diabetes mellitus type I. Alternative splicing of this gene results in multiple transcript variants encoding several different isoforms. [provided by RefSeq, Apr 2012]' Transcript Variant: This variant (4) contains an alternate 5' terminal exon (resulting in translation initiation from an alternate upstream start codon) and uses an alternate in-frame donor splice site in the 3' coding region compared to variant 2. The resulting shorter isoform (4, also known as HNF4alpha7) has a distinct N-terminus and lacks a 10 aa protein segment in the C-terminal region compared to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC211443 | HNF4A (Myc-DDK-tagged)-Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 5 |
USD 686.00 |
|
| RG211443 | HNF4A (GFP-tagged) - Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 5 |
USD 460.00 |
|
| RC211443L1 | Lenti ORF clone of Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 5, Myc-DDK-tagged |
USD 768.00 |
|
| RC211443L2 | Lenti ORF clone of Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 5, mGFP tagged |
USD 620.00 |
|
| RC211443L3 | Lenti ORF clone of Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 5, Myc-DDK-tagged |
USD 620.00 |
|
| RC211443L4 | Lenti ORF clone of Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 5, mGFP tagged |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China