MASP1 (NM_001031849) Human Untagged Clone

CAT#: SC302611

MASP1 (untagged)-Human mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor) (MASP1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MASP1
• Synonyms: 3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_001031849 edited
  ATGAGGTGGCTGCTTCTCTATTATGCTCTGTGCTTCTCCCTGTCAAAGGCTTCAGCCCAC
  ACCGTGGAGCTAAACAATATGTTTGGCCAGATCCAGTCGCCTGGTTATCCAGACTCCTAT
  CCCAGTGATTCAGAGGTGACTTGGAATATCACTGTCCCAGATGGGTTTCGGATCAAGCTT
  TACTTCATGCACTTCAACTTGGAATCCTCCTACCTTTGTGAATATGACTATGTGAAGGTA
  GAAACTGAGGACCAGGTGCTGGCAACCTTCTGTGGCAGGGAGACCACAGACACAGAGCAG
  ACTCCCGGCCAGGAGGTGGTCCTCTCCCCTGGCTCCTTCATGTCCATCACTTTCCGGTCA
  GATTTCTCCAATGAGGAGCGTTTCACAGGCTTTGATGCCCACTACATGGCTGTGGATGTG
  GACGAGTGCAAGGAGAGGGAGGACGAGGAGCTGTCCTGTGACCACTACTGCCACAACTAC
  ATTGGCGGCTACTACTGCTCCTGCCGCTTCGGCTACATCCTCCACACAGACAACAGGACC
  TGCCGAGTGGAGTGCAGTGACAACCTCTTCACTCAAAGGACTGGGGTGATCACCAGCCCT
  GACTTCCCAAACCCTTACCCCAAGAGCTCTGAATGCCTGTATACCATCGAGCTGGAGGAG
  GGTTTCATGGTCAACCTGCAGTTTGAGGACATATTTGACATTGAGGACCATCCTGAGGTG
  CCCTGCCCCTATGACTACATCAAGATCAAAGTTGGTCCAAAAGTTTTGGGGCCTTTCTGT
  GGAGAGAAAGCCCCAGAACCCATCAGCACCCAGAGCCACAGTGTCCTGATCCTGTTCCAT
  AGTGACAACTCGGGAGAGAACCGGGGCTGGAGGCTCTCATACAGGGCTGCAGGAAATGAG
  TGCCCAGAGCTACAGCCTCCTGTCCATGGGAAAATCGAGCCCTCCCAAGCCAAGTATTTC
  TTCAAAGACCAAGTGCTCGTCAGCTGTGACACAGGCTACAAAGTGCTGAAGGATAATGTG
  GAGATGGACACATTCCAGATTGAGTGTCTGAAGGATGGGACGTGGAGTAACAAGATTCCC
  ACCTGTAAAAAAAATGAAATCGATCTGGAGAGCGAACTCAAGTCAGAGCAAGTGACAGAG
  TGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001031849
• Insert Size: 1300 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001031849.1, NP_001027019.1
• RefSeq Size: 2072 bp
• RefSeq ORF: 1143 bp
• Locus ID: 5648
• Cytogenetics: 3q27.3
• Protein Families: Druggable Genome, Protease
• Protein Pathways: Complement and coagulation cascades
• Gene Summary: 'This gene encodes a serine protease that functions as a component of the lectin pathway of complement activation. The complement pathway plays an essential role in the innate and adaptive immune response. The encoded protein is synthesized as a zymogen and is activated when it complexes with the pathogen recognition molecules of lectin pathway, the mannose-binding lectin and the ficolins. This protein is not directly involved in complement activation but may play a role as an amplifier of complement activation by cleaving complement C2 or by activating another complement serine protease, MASP-2. The encoded protein is also able to cleave fibrinogen and factor XIII and may may be involved in coagulation. A splice variant of this gene which lacks the serine protease domain functions as an inhibitor of the complement pathway. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]'
  Transcript Variant: This variant (3) differs in the 3' UTR and 3' coding region, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1. This isoform (3) is referred to as MAp44 or MAP1 in the literature.