DEFB134 (NM_001033019) Human Untagged Clone
CAT#: SC302673
DEFB134 (untagged)-Human defensin, beta 134 (DEFB134)
"NM_001033019" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DEFB134 |
Synonyms | MGC163333; MGC163335 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001033019, the custom clone sequence may differ by one or more nucleotides
ATGAAGCCTCTCCTTGTTGTGTTTGTCTTTCTTTTCCTTTGGGATCCAGTGCTGGCAGGTATAAATTCAT TATCATCAGAAATGCACAAGAAATGCTATAAAAATGGCATCTGCAGACTTGAATGCTATGAGAGTGAAAT GTTAGTTGCCTACTGTATGTTTCAGCTGGAGTGCTGTGTCAAAGGAAATCCTGCACCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001033019 |
ORF Size | 201 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001033019.1, NP_001028191.1 |
RefSeq Size | 201 |
RefSeq ORF | 201 |
Locus ID | 613211 |
Protein Families | Secreted Protein, Transmembrane |
Gene Summary | Defensins are cysteine-rich cationic polypeptides that are important in the immunologic response to invading microorganisms. The antimicrobial protein encoded by this gene is secreted and is a member of the beta defensin protein family. Beta defensin genes are found in several clusters throughout the genome, with this gene mapping to a cluster at 8p23. [provided by RefSeq, Nov 2014] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211504 | DEFB134 (Myc-DDK-tagged)-Human defensin, beta 134 (DEFB134) |
USD 98.00 |
|
RG211504 | DEFB134 (GFP-tagged) - Human defensin, beta 134 (DEFB134) |
USD 460.00 |
|
RC211504L3 | Lenti ORF clone of Human defensin, beta 134 (DEFB134), Myc-DDK-tagged |
USD 620.00 |
|
RC211504L4 | Lenti ORF clone of Human defensin, beta 134 (DEFB134), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review